Prevalence of Hepatitis C Virus Genotypes in Bangladesh M. Johirul Islam1 (johir@icddrb.org), Md. Ahsan Habib1, Mohd. Raeed Jamiruddin1, Firoz Ahmed1, and Anowar Hossain1   1ICDDR,B, GPO Box 128, Dhaka 1000, Bangladesh

Background Hepatitis C virus (HCV), an infectious agent, affects the liver. It is estimated (WHO) that about 3% of the world’s population has been infected with HCV, and some 170 million are chronic carriers and at risk of developing liver cirrhosis and/or liver cancer. It is more prevalent in the African and Southeast Asian population. Of the 6 genotypes, 3 types (genotype 1, 2, and 3) are prevalent throughout the world, and the remaining 3 being restricted to particular geographical areas. No data on the prevalence pattern of HCV is available in Bangladesh. We retrospectively analyzed laboratory data from January 2005 to November 2010 on HCV detection and genotype determination available in molecular and sero-diagnostic unit of ICDDR,B.

Objective Review the results of HCV detection and genotyping Observe the prevalence of HCV genotype among the infected patients in Bangladesh who submitted specimens to the Molecular and Serodiagnostic Lab of the Clinical Laboratory Services

Methodology The 5-year laboratory data of HCV detection by anti-HCV (T) ELISA and genotype was retrospectively analyzed Briefly, the genotype was determined using amplified PCR product of 5’-untranslated region (5’UTR) that was subjected to sequencing and then HCV BLAST search through bioinformatics.

Workflow of HCV genotype determination Patient serum collection RNA extraction cDNA preparation and PCR amplification Sequencing Sequence read in ChromasPro NCBI Blast search & HCV Blast (Homology & Identification)

Results Of 4,168 samples, 451 (10.8%) were positive for anti-HCV (T). Of 451 ELISA positive cases, 252 (56%) samples were genotyped Of the genotyped patients, 176 (69.8%) were male and 76 (30.2%) were female. The mean age of the HCV nucleic acid-positive patients was 42.5 years, with a range of 19-74 years. Genotype 3b was most frequently prevalent (45.6%), followed by 1b (19.1%), 3a (18.7%), and 1a (12.7%); whereas 4a, 4c, 2a, and 2c were less commonly detected. Of 115 genotype 3b-positive cases, 72 (62.7%) were male, and 43 (47.4%) were female.

10 9 8 5 6 7 4 3 2 1 400 300 200 Figure 1: Agarose gel electrophoresis for the detection of HCV nucleic acid: Lane 1 and 10 represents the 100 bp marker (Bio-Rad, USA); Lane 2 represents the positive control (280 bp); Lane 3 represents the negative control; Lane 4 – 7 represents patients positive for HCV nucleic acid; Lane 8 – 9 represents patients negative for HCV nucleic acid.

Sequence pattern of 3b genotype Genotype: 3b GAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATCGCCGGGATGACCGGGTCCTTTCTTGGAGTAACCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCGAGATCACTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCCGGG

Sequence pattern of 3a genotype Genotype: 3a ACACCGGAATCGCTGGGGTGACCGGGTCCTTTCTTGGAACAACCCGCTCAATACCCAGAAATTTGGGCGTGCCCCCGCGAGATCACTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGG

Conclusion Nucleotide sequence analysis is regarded as the gold standard for the identification of different genotypes and subtypes. In this study, we used nucleotide sequence analysis for determining different HCV genotypes with high accuracy. Present study showed the higher prevalence of genotype 3b, which is similar to India and Pakistan. HCV genotype determination is of epidemiological importance and knowledge of the genotype is one of the main independent factors that influence the outcome of therapy. The genotype is also an appropriate determinant for taking therapeutic decision and determining its duration.

Conclusion (Contd.) The overall prevalence of HCV was higher than the global estimates reported by the WHO. Genotypes prevalent with the highest frequency of genotype 3b compared to all other genotypes in Bangladesh. This finding highlighted the presence and pattern of genotypes of HCV, which might have an implication in clinical decisions. However, to elucidate the actual prevalence and epidemiological pattern of HCV, a further study is required in broader settings both at hospitals and at community levels.

Acknowledgements: The study was funded by ICDDR,B and its donors which provide unrestricted support to ICDDR,B for operations and research. Corresponding Author: Dr. Anowar Hossain MD, IFCAP Scientist and Head, Clinical Laboratory Services LSD, ICDDR,B; E-mail: anowar@icddrb.org

Thank You