Structure and Replication of DNA

Outline DNA as the genetic material (16.2, 16.3, 16.4) Watson-Crick model of DNA Structure (16.5, 16.7, 16.6, 16.8,) Semiconservative model of DNA replication (16.9, 16.10, 16.11, 16.12, 16.13, 16.14, 16.15, 16.16, 16.17, ) Repair of Damaged DNA (16.18, 16.19) Telomerase extension of chromosome ends (16.20) Chromatin (16.21)

Are Genes Composed of DNA or Protein? Only four nucleotides thought to have monotonous structure Protein 20 different amino acids – greater potential variation More protein in chromosomes than DNA

Bacterial Transformation Experiments Fredrick Griffith (1928) –demonstrate the existence of “Transforming Principle,” a substance able to confer a heritable phenotype from one strain of bacteria to another. Avery MacLeod and McCarty – determine the transforming principle was DNA.

Streptococcus Pneumoniae

Griffith Experiment

Avery Experiment

Fig. 16-3 Phage head Tail sheath Tail fiber DNA 100 nm Bacterial cell

Hershey Chase Experiment

Additional Evidence Chargaff Ratios % A = %T and %G = %C (Complexity in DNA Structure) A T G C Arabidopsis 29% 29% 20% 20% Humans 31% 31% 18% 18% Staphlococcus 13% 13% 37% 37% DNA Content of Diploid and Haploid cells Gametes Somatic Cells Humans 3.25pg 7.30 pg Chicken 1.267pg 2.49pg

DNA Friedrich Meischer (1869) extracted a phosphorous rich material from nuclei of which he named nuclein DNA – deoxyribonucleic acid Monomer – Nucleotide Deoxyribose Phosphate Nitrogenous Base (4) Phosphodiester Bond DNA has direction - 5’ and 3’ ends Chromosomes are composed of DNA

Purine + purine: too wide Fig. 16-UN1 Purine + purine: too wide Pyrimidine + pyrimidine: too narrow Purine + pyrimidine: width consistent with X-ray data

Watson and Crick Model Franklins X-Ray Data Watson and Crick DNA is Double Helix 2 nm diameter Phosphates on outside 3.4 nm periodicity Bases 0.34nm apart Watson and Crick Base Pairing

DNA Replication Semiconservative Replication

Other Models of Replication Conservative Replication Semi-Conservative Replication Dispersive Replication

Density Centrifugation Culture Bacteria in 15N isotope (DNA fully 15N) One Cell Division in 14N 2nd Cell Division in 14N Less Dense More Dense 14N DNA 15N/14N DNA 15N/14N DNA 15N DNA Density Centrifugation

DNA Replication: A Closer Look The copying of DNA is remarkable in its speed and accuracy More than a dozen enzymes and other proteins participate in DNA replication Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Origins of Replication Video

At the end of each replication bubble is a replication fork, a Y-shaped region where new DNA strands are elongating Helicases are enzymes that untwist the double helix at the replication forks Single-strand binding protein binds to and stabilizes single-stranded DNA until it can be used as a template Topoisomerase corrects “overwinding” ahead of replication forks by breaking, swiveling, and rejoining DNA strands Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Single-strand binding proteins Fig. 16-13 Primase Single-strand binding proteins 3 Topoisomerase 5 3 RNA primer Figure 16.13 Some of the proteins involved in the initiation of DNA replication 5 5 3 Helicase

DNA Polymerase 3’ 5’ Pol 3’ 5’

Leading and Lagging Strands 3’ 5’ Pol Leading Strand 5’ Lagging Strand 3’ Pol RNA Primer 3’ Okazaki Fragments 5’ Video

Other Proteins at Replication Fork 3’ 5’ DNA Pol III Single Stranded Binding Proteins Pol Leading Strand 5’ DNA Pol I Lagging Strand 3’ Pol Ligase Helicase Primase 3’ Okazaki Fragments 5’

Overall directions of replication Fig. 16-16 Overview Origin of replication Leading strand Lagging strand Lagging strand 2 1 Leading strand Overall directions of replication 3 5 5 3 Template strand 3 RNA primer 3 5 1 5 Okazaki fragment 3 5 3 1 5 5 3 3 Figure 16.6 Synthesis of the lagging strand 2 1 5 3 5 3 5 2 1 5 3 3 1 5 2 Overall direction of replication

Damaged DNA Nuclease Excision Repair DNA Polymerase Ligase

Replicating the Ends of DNA Molecules Limitations of DNA polymerase create problems for the linear DNA of eukaryotic chromosomes The usual replication machinery provides no way to complete the 5 ends, so repeated rounds of replication produce shorter DNA molecules Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Replicating Ends of Linear Chromosomes

Fig. 16-19 Figure 16.19 Shortening of the ends of linear DNA molecules 5 Ends of parental DNA strands Leading strand Lagging strand 3 Last fragment Previous fragment RNA primer Lagging strand 5 3 Parental strand Removal of primers and replacement with DNA where a 3 end is available 5 3 Second round of replication Figure 16.19 Shortening of the ends of linear DNA molecules 5 New leading strand 3 New lagging strand 5 3 Further rounds of replication Shorter and shorter daughter molecules

Fig. 16-20 Figure 16.20 Telomeres 1 µm

If chromosomes of germ cells became shorter in every cell cycle, essential genes would eventually be missing from the gametes they produce An enzyme called telomerase catalyzes the lengthening of telomeres in germ cells Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Telomerase

Chromatin Structure DNA, the double helix Histones Nucleosome (10 nm in diameter) DNA double helix (2 nm in diameter) H1 Histone tail Histones DNA, the double helix Histones Nucleosomes, or “beads on a string” (10-nm fiber) video

Looped domains (300-nm fiber) Metaphase chromosome Fig. 16-21b Chromatid (700 nm) 30-nm fiber Loops Scaffold 300-nm fiber Replicated chromosome (1,400 nm) 30-nm fiber Looped domains (300-nm fiber) Metaphase chromosome

30 nm chromatin fiber Held together by histone tails interacting with neighboring nucleosomes Inhibits transcription Allows DNA replication

Gene Expression Beadle and Tatum Exp Transcription Translation Roles of RNA

Beadle and Tatum Isolation of Nutritional Mutants

One Gene – One Polypeptide Intermediates in arginine biosynthesis Mutant Ornithine Citrulline Arginine arg-1 + arg-2 - arg-3 -  Note: A plus sign means growth; a minus sign means no growth. arg-1 arg-2 arg-3 Percursor Ornithine Citruline Arginine One Gene – One Enzyme One Gene – One Polypeptide

Central Dogma of Molecular Biology

Gene Structure Transcribed Region Promoter Terminator ) ( RNA Open Reading Frame 5’UTR 3’UTR

Three Parts to Transcription Transcriptional Initiation – RNA polymerase binds to promoter DNA strands separate RNA synthesis begins as ribonucleotides complementary to template strand are linked Transcriptional Elongation RNA polymerase moves down DNA unwinding a small window of DNA. Nucleotides are added to the growing RNA chain Transcriptional Termination When the RNA polymerase reaches terminator the RNA and the RNA polymerase are released from the DNA.

RNA Processing in Eukaryotes Pre-mRNA (hnRNA) 5’ 3’ Modification of 5’ and 3’ ends 5’CAP Poly A tail Exon1 Intron1 Exon2 Intron2 Exon3 Intron3 Exon4 Spicing of exons

Genetic Code

Locate start codon (1st ATG from 5’ end) Identifying ORF 5’ GACGACGGAUGCGCAAUGCGUCUCUAUGAGACGUAGCUCAC Locate start codon (1st ATG from 5’ end) Identify Codons (non overlapping units of three codons including and following start codon) Stop at stop codon ( remember stop codon doesn’t encode amino acid) Nucleotides before start codon – 5’UTR Nucleotides after stop codon -3’UTR [MetArgAsnAlaSerLeu]

(a) Tobacco plant expressing a firefly gene (b) Pig expressing a Fig. 17-6 Figure 17.6 Expression of genes from different species (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

Players in Translation mRNA – Genetic Code Ribosome – synthesizes protien tRNA – adaptor molecule Amino acids Aminoacyl tRNA synthetases - attach amino acids to tRNAs

GDP GDP Amino end of polypeptide E 3 mRNA Ribosome ready for Fig. 17-18-4 Amino end of polypeptide E 3 mRNA Ribosome ready for next aminoacyl tRNA P site A site 5 GTP GDP E E P A P A Figure 17.18 The elongation cycle of translation GDP GTP E P A

tRNA

Ribosomes

Three parts to Translation Initiation Delivery of Ribosome with first tRNA to start codon. Elongation Cycle Three Parts of Elongation Cycle Delivery of tRNA to A site Transpeptidase Activity – Amino acids on tRNA in P site cleaved from tRNA and attached to amino acid on tRNA in A site. Translocation – Ribosome ratchets over on codon. The tRNA that was in the A site is moved to the P site. The uncharged tRNA in the P site exits the ribosome through the E site. Termination When ribosome reaches the stop codon a release factor binds to the A site and triggers the release of the polypeptide. The ribosome releases the tRNA and the mRNA.

The Functional and Evolutionary Importance of Introns Some genes can encode more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing Such variations are called alternative RNA splicing Because of alternative splicing, the number of different proteins an organism can produce is much greater than its number of genes Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Gene DNA Exon 1 Intron Exon 2 Intron Exon 3 Transcription Fig. 17-12 Gene DNA Exon 1 Intron Exon 2 Intron Exon 3 Transcription RNA processing Translation Domain 3 Figure 17.12 Correspondence between exons and protein domains Domain 2 Domain 1 Polypeptide

Polysomes

Polypeptide synthesis always begins in the cytosol Synthesis finishes in the cytosol unless the polypeptide signals the ribosome to attach to the ER Polypeptides destined for the ER or for secretion are marked by a signal peptide Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

A signal-recognition particle (SRP) binds to the signal peptide The SRP brings the signal peptide and its ribosome to the ER Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Proteins targeted to ER

Functions of RNA mRNA – genetic code tRNA – adaptor molecules rRNA- part of ribosome snRNA – part of splicosome SRP RNA – part of SRP siRNA- eukaryotic gene regulation

Silent Mutations Missense Mutations Nonsense Mutations