Effectiveness of SNPs genotyping assay as a tool for genetic traceability of cattle production chain Anna Pozzi 36° International Society for Animal Genetics Conference 16th – 21st July 2017 Animal Forensic Genetics Workshop

FOOD SAFETY & CONSUMERS EU greater control over processing and distribution channels through TRACEABILITY FOOD SAFETY & CONSUMERS 1. ingredients and finished products 2.ACCURATE/ SAFE ANIMAL IDENTIFICATION 3. Genetic traceability as a way to further enhance conventional traceability Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Spallanzani Institute Rivolta d’Adda (CR) Since 1996 involved in Official Semen Control 1997 start in Italy “IDENTITY TEST” (IT) To verify correct identity of bulls producing frozen semen for Artificial Insemination Centre (AI)   Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Genetic traceability experience From Services… biological reference semen sample Genetic profile of DNA extracted from sample batch Genetic profile of DNA extracted from biological reference (blood or semen) AI centres send when young broodstock begin to produce Identity test OK Identity test NO Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Genetic traceability experience …to research 2005-2006 Genetic traceability in typical Italian products (PDO) chain (Salame VARZI) 2014-2015 TRACCIA Project Development of small fingerprinting protocol by SNPS for traceability in food supply chain 2002-2006 RAIZ Project development of a RealTime PCR assay for Myostatin point mutation in Piedmontese breed 2003-2004 COGECA genetic traceability to support the conventional paper-based traceability in beef production chain Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Genetic traceability evolution From Microsatellites… ..to SNPs gacctaatcacacacataccata gacctaatcacacacacacacacacacacacacacatacca gacctaatcacacacacacacacacataccata International standard for parental verification, genetic id, traceability + high degree of polymorphism - higher cost - error rate - turnaround time - not comparable + abundance + cost efficiency + potential for automation - lower informativity due bi allelic nature Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Constructed new 32 SNPs panel MAF 0.5 Previous study 11 microsatellite markers StockMarks for Cattle Bovine Genotyping Kit 128 SNPs 88 ISAG Bovine Comp. Test 40 selected from NCBI database 353 bulls, 15 breeds Constructed new 32 SNPs panel MAF 0.5 Allele frequencies for SNPs and STRs: direct counting . Genetic Variability PIC, He, Ho, Fis PI , MAF   Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Previous study Informativeness of the 32 SNPs panel at the breed level Cattle breed Ho He Fis PI MAF n (MAF<0.3) Belgian Blue 0.40 0.42 0.04 1.02 E-12 0,357 9 Italian Brown 0.41 0.03 1.29 E-12 0,342 10 Castana 0.45 0.43 -0.03 4.01 E-13 0,370 8 Chianina 0.39 0.00 5.32 E-12 0,315 11 Italian Holstein 7.13 E-13 0,345 Grigio Alpina 0.44 1.35 E-13 0,396 4 Limousin 0.46 0.06 9.24 E-14 0,408 1 Marchigiana -0.06 1.20 E-12 0,341 Italian Red Pied 0.48 -0.04 7.80 E-14 0,410 Piedmontese 9.81 E-14 0,420 Pinzgau -0.09 3.65 E-13 0,377 7 Reggiana 1.15 E-13 0,403 3 Rendena 2.95 E-13 0,372 Romagnola 3.06 E-12 0,336 12 Aosta Red Pied 0,339 All samples (353) 0.09 2.53 E-14 0,475 PI (11 MS)= 1.95 X 10 -12 Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Goals Verify the amount information of 32 SNPs finger printing protocol applied in the food supply chain Test 32 SNPs fingerprinting protocol on different matrices Milk instead of Blood Protocol for DNA extraction from milk 1° 2°   Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

32 SNPs Methods & Materials 140 samples 50 semen batches Traceability on food supply chain on several matrices 140 samples 50 semen batches 30 meat samples 30 hair samples 30 MILK SAMPLES OPEN ARRAY platform SNP Genotyping sw TaqMan Genotyper 1.0 sw DNA extraction Bio Sprint 96 DNA Blood Kit- specific modifications Mag Attract technology developed protocol for milk 32 SNPs Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Methods & Materials 32 SNPs panel Animal Forensic Genetics Workshop SNP ID Chromosome RefSNP Allele 1 Allele 2 ISAG_1.3 1 rs29012842 A C ISAG_1.6 rs29019282 T ISAG_3.2 3 rs29001956 ISAG_3.5 rs29026932 G ISAG_4.2 4 rs29014143 ISAG_5.4 5 DQ500958 ISAG_6.2 6 rs29013632 ISAG_7.1 7 rs29012174 ISAG_8.2 8 rs29024525 ISAG_8.3 rs29011266 ISILS_8.1 rs29021017 ISILS_9.5 9 rs29010513 ISAG_10.4 10 rs29012457 ISAG_10.5 rs29012019 ISAG_12.1 12 rs29020472 ISILS_13.2 13 rs29026756 ISAG_14.4 14 rs29027559 ISAG_15.1 15 DQ866817 ISAG_15.3 EF042090 ISILS_16.6 16 rs29012001 ISAG_17.2 17 AY860426 ISAG_18.4 18 rs29014953 ISAG_20.2 20 DQ888313 ISILS_20.5 rs29012629 ISAG_21.1 21 DQ995976 ISILS_23.1 23 rs29027007 ISILS_23.4 rs29022896 ISAG_24.3 24 rs29020834 ISAG_27.3 27 rs29015783 ISAG_28.4 28 rs29014974 ISAG_29.2 29 DQ404153 ISILS_29.2 rs29022285 Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Viability of 32 SNPS panel Results Informativeness 32 SNPs SNP ID Ho He FI PE(1) PE(2) PI ISAG_1.3 0.46 0.50 0.08 1,87E-1 1,88E0 3,75E-1 ISAG_1.6 0.52 -0.04 1.87E-1 1.87E0 3.75E-1 ISAG_10.4 0.60 -0.20 ISAG_10.5 0.55 -0.09 ISAG_12.1 0.43 0.14 1.88E0 3.76E-1 ISAG_14.4 0.07 ISAG_15.1 0.51 -0.02 ISAG_15_3 0.48 0.04 ISAG_17.2 0.39 0.47 0.17 1.80E-1 3.91E-1 ISAG_18.4 0.49 0.03 1.86E-1 3.77-E1 ISAG_20.2 3.77E-1 ISAG_21.1 0.01 1.85E-1 3.78E-1 ISAG_24.3 0.06 3.79E-1 ISAG_27.3 0.13 ISAG_28.4 -0.01 1.84E-1 3.81E-1 ISAG_29.2 0.41 0.16 ISAG_3.2 -0.05 ISAG_3.5 0.54 -0.07 ISAG_4.2 -0.13 1.82E-1 3.86E-1 ISAG_5.4 0.22 ISAG_6.2 0.44 3.89E-1 ISAG_7.1 ISAG_8.2 ISAG_8.3 0.09 3.82E-1 ISILS_13.2 ISILS_16.6 0.53 -0.06 ISILS_20.5 0.38 0.23 ISILS_23.1 ISILS_23.4 -0.03 ISILS_29.2 ISILS_8.1 -0.12 3.90E-1 ISILS_9.5 All   8.40E-14 Results about 1st goal Viability of 32 SNPS panel PI value confirms: the results obtained in our previous work data found in bibliography Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Blood Milk Methods & Materials Sampling No veterinary Easy sampling No stress Easy sampling No veterinary stress Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Milk : alternative DNA source Methods & Materials Milk : alternative DNA source Several protocol for DNA isolation published: showed different difficulties Milk Blood Quantity /quality for different applications Standardised approaches Small Volumes Low DNA quantity/quality not for large scale genotyping Large volumes are necessary   Develop an innovative protocol Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

Methods & Materials Milk protocol 30 milk samples from Italian Holstein Somatic cells count (ranging from 16 x 103 to 97 x 104 ) 3 groups SCC <100.000 cells/mL SCC <200.000 cells/mL SCC >300.000 cells/mL Additive Sodium Azide No Additive   1 day 3 days 5 days Storage condition: ambient, refrigerated and frozen quantity and quality DNA were investigated samples refrigerated and frozen: no significative differences we excluded ambient conservation (Results not presented here) Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

32 SNPs panel Conclusion can be a in addition valid fingerprinting tool for … 32 SNPs panel breeding plans disease monitoring pedigree analysis Agri-Food traceability in addition can be an important tool Animal Milk Meat Tannery Reproduction   not only as a control ( to avoid fraud) but especially for : Producers, to implement the value of their products Consumers, to guarantee the real product origin, expecially for products as PDO and PGI, of which Italy is rich. in the agri-food supply chain (milk, meat, tannery, reproduction).. Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop

THANK YOU ! anna.pozzi@istitutospallanzani.it Molecular Genetic Lab Graziella Bongioni – lab head Anna Pozzi Cristina Previtali Rossana Capoferri Caterina Cambuli Sabina Arabi Silvia Cenadelli Dublin, 17 July 2017 A. Pozzi Animal Forensic Genetics Workshop