Using artificial microRNAs to induce Cassava Brown Streak Disease resistance in cassava Henry Wagaba

Outline Introduction RNA interference (RNAi) using UCBSV and CBSV coat protein sequences Use of artificial microRNAs (amiRNAs) to induce CBSD resistance Conclusions

Genome structure of CBSD causing viruses UCBSV genome CBSV genome 70% nucleotide identity UCBSV isolates share 87 - 99% nucleotide identity CBSV isolates share 79 - 95% nucleotide identity Family: Potyviridae Genus: Ipomoviridae Encodes the P1 serine proteinase that suppresses RNA silencing Contains a Maf/HamHI-like gene-pyrophosphatase Lacks the helper component proteinase (HC-pro) It is perhaps interesting to speculate that this could be a reflection of how relatively few viruses are able to infect Euphorbiaceae hosts ICTV’s species demarcation is <75% nucleotide identity or difference in polyprotein cleavage sites

RNAi strategy by expression of dsRNA targeting CBSV coat protein 6K1 C1 6K2 Vpg NiaPro NIb Ham1H CP 5’UTR 3’UTR FL-CP UCBSV (1101 bp) Δ FL-CP UCBSV (896 bp) NT-CP UCBSV (400bp) CT-CP UCBSV (500 bp) Cloned in sense and antisense orientation pCsVMV UCBSV-S UCBSV-AS Pdk Intron TNos

Virus challenge with different homologous UCBSV isolates using sap inoculation UCBSV-AS Tnos UCBSV-S Pdk intron pCsVMV UCBSV isolates

Virus challenge with different non-homologous CBSV isolates using sap inoculation UCBSV-AS Tnos UCBSV-S Pdk intron pCsVMV CBSV isolates

RT-PCR to detect UCBSV and CBSV in challenged transgenic in selected N RT-PCR to detect UCBSV and CBSV in challenged transgenic in selected N. benthamiana lines Controls FL CT NT UCBSV-[UG:Kab:07] (1101nt) CBSV-[TZ:Zan:07] (1134nt) Patil et al., Molecular Plant Pathology (2011) 12(1), 31–41

Screening for resistance to CBSD in N Screening for resistance to CBSD in N. benthamiana RNAi transgenic lines Transgenic FL17 line challenged with UCBSV (homologous virus) [Isolate: Kenya:Mwalumba:07]

Grafting challenge of transgenic cassava Cv. 60444 with UCBSV Transgenic resistant root-stock Transgenic resistant CBSD Infected scion UCBSV source 2-3 months after grafting

siRNA expression and UCBSV challenge of transgenic cassava lines Expt1 Expt2 Wild type 60444 8/8 (0%) 10/10 (0%) 718.001 0/8 (100%) 0/7 (100%) 718.003 0/3 (100%) 718.004 0/9 (100%) 718.008 0/6 (100%) 718.007 Not tested 718.012 0/2 (100%) 0/31 (100%) Yadav et al., Molecular Plant Pathology (2011) 12(7), 677–687

Cloning of N-Terminal and ΔFL hairpin constructs using coat protein sequences from UCBSV and CBSV pCsVMV ΔCP-FL CBSV Pdk intron ΔFL CBSV T-Nos CBSV NT CP ΔCP-FL CBSV ΔCP-FL UCBSV ΔCP-FL-UCBSV

Transient siRNA expression and protection in N. benthamiana Transformed into N. benthamiana and cassava Next-> Challenge transgenic T0 lines to test for resistance

The use of Artificial microRNAs in virus protection Virus targeted Virus Genes targeted Resistance acquired? Plants tested Precursor used Niu et al., (2006) Turnip Yellow mosiac virus (TYMV) P69 (silencing suppressor) Yes A. thaliana miRNA159a (A. thaliana) Turnip mosaic virus (TuMV) Hc-pro (suppressor) Qu et al., 2007 Cucumber mosaic virus (CMV) 2b (silencing suppressor) N. benthamiana miRNA171a (A. thalaiana) Zhang et al., 2010 2a and 2b Tomato 3’UTR Fahim et al., 2011 Wheat streak mosaic virus (WSMV) Conserved regions Wheat miR395 (rice) polycistronic Ai et al., 2011 Potato virus Y Coat protein Potato

Advantages of using amiRNAs Use of the artificial microRNA (amiRNA) strategy against UCBSV and CBSV Advantages of using amiRNAs Multiple targeting is possible Very specific with fewer off-target effects to complementary host-targets microRNAs also active at low temperature Sablok et al., 2011 Degradation of viral RNA Process of plant genetic transformation using amiRNAs

Cloning of UCBSV and CBSV amiRNA using the A. thaliana miR159a backbone CAGTTTGCTTATGTCAGATCCATAATATATTTGACAAGATACTTTGTTTTTCGATAGATCTTGATCTGACGATGGAAGTAGAGCTCCTTAAAGTTCAAACATGAGTTGAGCAGGGTAAAGAAAAGCTGCTAAGCTATGGATCCCATAAGCCCTAATCCTTGTAAAGTAAAAAAGGATTTGGTTATATGGATTGCATATCTCAGGAGCTTTAACTTGCCCTTTAATGGCTTTTACTCTTCTTTGGATTGAAGGGAGCTCTACAT A. thaliana miR159a - 273 bp predicted folded structure Target XbaI site 21-nt target miR159a-P1[CBSV] TCATCTAGATGATCTGACGATGGAAGATGGTGAGACCTGGTTGGAGTCATGAGTTGAGCAGGGTAAAG miR159a-P1[UCBSV] TCATCTAGATGATCTGACGATGGAAGATGATTCGTCCTGGATGGAGTCATGAGTTGAGCAGGGTAAAG miR159a-Nib[UCBSV] TCATCTAGATGATCTGACGATGGAAGGATTGTGATGGTAGTAGGTTTCATGAGTTGAGCAGGGTAAAG miR159a-CP [UCBSV] TCATCTAGATGATCTGACGATGGAAGCTGGCAGCGAATGTTGGTAGACATGAGTTGAGCAGGGTAAAG tNos A. thaliana miR159a - 273 bp Sense Anti-sense pCsVMV

Transient expression and protection from amiRNAs against CBSV

Aligned sequence regions of P1, Nib and CP targeted genes of UCBSV and CBSV miR159a-P1[UCBSV] miR159a-CP[UCBSV] miR159a-P1[CBSV] miR159a-NIb[UCBSV] UCBSV CBSV

Summary of selected CBSV and UCBSV genes targeted amiRNA Targeted UCBSV or CBSV Transient miRNA expression Transient protection Stable expression in N. benthamiana miR159a-P1[CBSV] CBSV Positive +++ Yes miR159a-P1[UCBSV] UCBSV ++ miR159a-Nib[UCBSV] Both miR159a-CP [UCBSV]

Stable protection against CBSV and UCBSV in N. benthamiana T2 lines There is a variation in versus differential expression pattern of amiRNAs versus resistance There is possibly differential uptake of dsRNAs by AGO proteins AGO proteins may bind to the target RNA and amplification of target miRNAs P1-CBSV

Virus resistant line miR159a-CP[UCBSV] challenged with UCBSV LINE 10-4 plants Control plants

Future activities on artificial microRNAs Characterize T3 N. benthamiana plants transformed with amiRNA constructs; map cleavage sites using 5’ RACE amplification of the signal Concatemer 21nt miRNAs to target different genes of both UCBSV and CBSV Transform them into cassava for CBSV and UCBSV protection The effect of RNA silencing in plants can be amplified if the production of secondary small interfering RNAs (siRNAs) is triggered by the interaction of microRNAs (miRNAs) or siRNAs with a long target RNA. miRNA and siRNA interactions are not all equivalent, however; most of them do not trigger secondary siRNA production. Here we use bioinformatics to show that the secondary siRNA triggers are miRNAs and transacting siRNAs of 22 nt, rather than the more typical 21-nt length. Agrobacterium-mediated transient expression in Nicotiana benthamiana confirms that the siRNA-initiating miRNAs, miR173 and miR828, are effective as triggers only if expressed in a 22-nt form and, conversely, that increasing the length of miR319 from 21 to 22 nt converts it to an siRNA trigger. We also predicted and validated that the 22-nt miR771 is a secondary siRNA trigger. Our data demonstrate that the function of small RNAs is influenced by size, and that a length of 22 nt facilitates the triggering of secondary siRNA production.

Conclusions The delta-FL-UCBSV CP sequence protects against both UCBSV and CBSV in N. benthamiana, and cassava Artificial microRNAs targeting P1, Nib and CP genes of UCBSV and CBSV have a potential to protect against UCBSV and CBSV in N. benthamiana, when fused, may lead to more durable resistance

Acknowledgement VIRCA project Academic advisors Millennium Science Initiative (MSI) ILTAB members Greenhouse staff Makerere University Academic advisors Dr. Mukasa Ssettumba Dr. Nigel Taylor Dr. Yona Baguma Dr. Titus Alicai Dr. Claude M. Fauquet Donald Danforth Plant Science Center

VIRCA acknowledges support by