Table S1. Primers used in this study.

Slides:

Advertisements

Similar presentations

Copyright © 2010, 2007, 2004 Pearson Education, Inc. All Rights Reserved.Copyright © 2010 Pearson Education Section 2-3 Histograms.

Advertisements

P449. p450 Figure 15-1 p451 Figure 15-2 p453 Figure 15-2a p453.

Organizing and Graphing Quantitative Data Sections 2.3 – 2.4.

Graphing Examples Categorical Variables

Graphing A Practical Art. Graphing Examples Categorical Variables.

 Quantitative Numbers  Qualitative Descriptions.

Supporting Figure S1A Scatter plots of MSH6 expression against the café-au-lait macule burden (CALM) phenotype. The upper panel of plots represents the.

Total Population of Age (Years) of People. Pie Chart of Males and Females that Smoke Systematic Gender Sample Total Population: 32.

CO_02.jpg. 2.2 Graphs and Tables for Quantitative Data Objectives: By the end of this section, I will be able to… 1) Construct and interpret a frequency.

Supplementary data 2: Reproducibility of metabolite MSI Reproducibility of MSI data was evaluated by mean ± standard deviation (5 biological replications).

Volume 10, Issue 10, Pages (October 2017)

From: Enhancement of rAAV2-Mediated Transgene Expression in Retina Cells In Vitro and In Vivo by Coadministration of Low-Dose Chemotherapeutic Drugs Invest.

Matrix Metalloproteinase-9 Is Required for Tumor Vasculogenesis but Not for Angiogenesis: Role of Bone Marrow-Derived Myelomonocytic Cells G-One Ahn,

Bin Wu, Jeffrey A. Chao, Robert H. Singer Biophysical Journal

Altered biological activity of peroxynitrite-modified nerve growth factor (NGF) compared to native NGF in vitro. A: Dorsal root ganglia (DRG) neurons that.

Volume 15, Issue 8, Pages (May 2016)

Volume 20, Issue 13, Pages (September 2017)

Volume 109, Issue 8, Pages (October 2015)

IRF4 is required for anabolic induction of CD4+ T cells.

Volume 21, Issue 3, Pages (September 2011)

Volume 10, Issue 10, Pages (October 2017)

Volume 28, Issue 1, Pages (January 2014)

Graph the function, not by plotting points, but by starting with the graph of the standard functions {image} given in figure, and then applying the appropriate.

Hermann Broder Schmidt, Rajat Rohatgi Cell Reports

Volume 16, Issue 3, Pages (February 2006)

Mutual Repression by Bantam miRNA and Capicua Links the EGFR/MAPK and Hippo Pathways in Growth Control Héctor Herranz, Xin Hong, Stephen M. Cohen Current.

Volume 121, Issue 5, Pages (June 2005)

Volume 26, Issue 5, Pages (September 2013)

Volume 5, Issue 3, Pages (May 2012)

Unexpectedly Complex Regulation of CD4/CD8 Coreceptor Expression Supports a Revised Model for CD4+CD8+ Thymocyte Differentiation Bruno Lucas, Ronald.

Volume 12, Issue 3, Pages (July 2015)

Michael J. Mitchell, Kimberly S. Lin, Michael R. King

Volume 25, Issue 3, Pages (March 2014)

Volume 7, Issue 10, Pages (October 1997)

Notch1 Signaling Promotes the Maturation of CD4 and CD8 SP Thymocytes

The WUSCHEL Related Homeobox Protein WOX7 Regulates the Sugar Response of Lateral Root Development in Arabidopsis thaliana Danyu Kong, Yueling Hao, Hongchang.

Individual genes exhibit distinct stage-specific expression among female gametocytes. Individual genes exhibit distinct stage-specific expression among.

Matrix Metalloproteinase-9 Is Required for Tumor Vasculogenesis but Not for Angiogenesis: Role of Bone Marrow-Derived Myelomonocytic Cells G-One Ahn,

Volume 16, Issue 2, Pages (January 2006)

Individual genes exhibit distinct female-enriched expression patterns.

AURORA-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol Shubha Anand, Sue Penrhyn-Lowe, Ashok R Venkitaraman

Rapid Actin-Based Plasticity in Dendritic Spines

Validation of knock‐in cell line and image calibration (related to Fig 1)‏ Validation of knock‐in cell line and image calibration (related to Fig 1) Validation.

Massimo A. Hilliard, Cornelia I. Bargmann Developmental Cell

Silencing of transposon RNAs during oogenesis is essential for embryonic development. Silencing of transposon RNAs during oogenesis is essential for embryonic.

Volume 44, Issue 4, Pages (April 2016)

K. Venkatesan Iyer, S. Pulford, A. Mogilner, G.V. Shivashankar

Use the graph of f to find the following limit. {image} {applet}

Global Hypertranscription in the Mouse Embryonic Germline

Volume 3, Issue 3, Pages (March 2013)

Volume 14, Issue 7, Pages (February 2016)

Yuichiro Mishima, Yukihide Tomari Molecular Cell

The Membrane-Lytic Peptides K8L9 and Melittin Enter Cancer Cells via Receptor Endocytosis following Subcytotoxic Exposure Masayuki Kohno, Tomohisa Horibe,

Chien-Jung Lo, Mark C. Leake, Richard M. Berry Biophysical Journal

Figure 2 P2Y12 expression is upregulated in M2-polarized human microglia(A, B) Using TaqMan quantitative real-time PCR, P2Y12 expression was measured in.

dex-1 expression in the seam cells is regulated by DAF-16.

Volume 23, Issue 7, Pages (July 2016)

Which of the following expressions is the equation of the function {image} {applet}

FACT facilitates the deposition of H2A–H2B onto a hexasome.

Ruth D. Taylor, Martin Heine, Nigel J. Emptage, Laura C. Andreae

FRAP and FLIP analysis of GFP-ADAR2 and GFP-ADAR1C-Term.

Memory-biased TCRs induce weaker TCR signals than effector-biased TCRs in vitro. Memory-biased TCRs induce weaker TCR signals than effector-biased TCRs.

Taro Ohkawa, Matthew D. Welch Current Biology

Volume 15, Issue 2, Pages (February 2012)

Genes that Respond to H2O2 Are Also Evoked Under Light in Arabidopsis

Hermann Broder Schmidt, Rajat Rohatgi Cell Reports

Enhancer Control of Transcriptional Bursting

Cell Sorting of Induced SE-like Cells Using SEOR1pro:SEOR1-YFP.

GBM cells infected in vitro with HCMV divide less often than uninfected cells do. GBM cells infected in vitro with HCMV divide less often than uninfected.

Primary GBM cells are permissive to HCMV in vitro.

Presentation transcript:

Table S1. Primers used in this study. Sequences F1 CACATTTATCAATACAATTGCG R1 CAAGAATTGGGACAACTCCAGTG R1-1(Tub 5’ R) CGTTCGTAAAACGTTAGATAA Tub 5’ F GTACACATGTAAAATACCTC F2 GCTCGCAAATGGCCAAATAAG R2 GATTGTAGCCGTTGCTCTTTC R2-1 GTTATTCCTTTTCTAGTTTAAAATATAC F3 GGTTATGTGTGGGAGGGC R3 CTTGACATATTGTGTTCATGATATATG F3-1 GTAATCTTCCTTATAAATATAGAATAATG

Figure S1. Mature gametocytes of the transgenic line 3D7α-tubII/GFP Figure S1. Mature gametocytes of the transgenic line 3D7α-tubII/GFP. The graphs show strong GFP expression in both male and female gametocytes. Upper panel, GFP fluorescence. Lower panel: Bright field image showing a male gametocyte (left) with dispersed chromatin and a female gametocyte (right) with condensed chromatin.

Fluorescence intensity Figure S2. Scatter plots showing the gating signals and fluorescence intensity at 0.02% gametocytemia of stage I to V gametocytes.

A B GFP JC-1 Figure S3. Comparative quantitation of GFP and JC-1 signal intensity after treatment with PMQ. The areas under curves in the histogram show the fluorescence intensities (FI) of GFP (A) and JC-1 (B) of stage V gametocytes with or without PMQ treatment. PMQ treatment was done at 62.5 – 500 M.

Figure S4. Drug response curves of stage I – V gametocytes to chloroquine (CQ), dihydroartemisinin (DHA), primaquine (PMQ) and pyronaridine (PND). The graphs show the fluorescence intensity (FI) values of the gametocytes with the error bars representing the standard error of the FI from three biological replicates.