Bioinformatics Tools for Comparative Genomics of Vectors

Slides:



Advertisements
Similar presentations
Model Organism Databases and Community Annotation
Advertisements

Working Group Meeting 2013 Objective 3: Deploy tools to increase user-specified flexible queries.
The Arabidopsis Information Resource (TAIR)
Putting TAIR to work for you hands-on workshop for beginning and advanced users
May 16, 2005Scott Cain, CSHL. May 16, 2005Scott Cain, CSHL gmod update Gmod RC2 last week New for 0.003: –Generic triggers for Apollo –Greatly enhanced.
BLOSUM62. Sequencia desconhecida GTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACA CCCTGCCGGTGACGACGCCGCAGAATTTGCAGACCGCCACTTACGGCAGCACGTTGAGTGGCGACAATCACAGTCGTCTGAT.
2 Unité de Biométrie et d’Intelligence Artificielle (UBIA) INRA
GDR, the Genome Database for Rosaceae, in Chado and Tripal Sook Jung, Stephen Ficklin, Taein Lee, Chun-Huai Cheng, Anna Blenda, Sushan Ru, Ping Zheng,
Genome Data Directories Don Gilbert, May 2003.
Genome Browsers Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.
Bootcamp: Data Resources1 Paul Bain Reference and Education Services Librarian Countway Library of Medicine Countway.
Genome Annotation BCB 660 October 20, From Carson Holt.
Help Desk Update January 2010 GMOD Meeting January 2010 Dave Clements GMOD Help Desk US National Evolutionary Synthesis Center (NESCent)
GMOD: Building Blocks for a Model Organism System Database Lincoln Stein, CSHL.
WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein.
GMOD in the Cloud Genome Informatics November 3, 2011 Scott Cain GMOD Project Coordinator Ontario Institute for Cancer Research
WFleaBase Daphnia Genome Database from Common Components Daphnia Genomic Consortium Meeting, Sept Don Gilbert,
Sequence Analysis with Artemis & Artemis Comparison Tool (ACT) South East Asian Training Course on Bioinformatics Applied to Tropical Diseases (Sponsored.
WebGBrowse A Web Server for GBrowse Configuration Ram Podicheti B.V.Sc. & A.H. (D.V.M.), M.S. Staff Scientist – Bioinformatics Center for Genomics and.
EBI is an Outstation of the European Molecular Biology Laboratory. Every genome deserves a home Dan Lawson EMBL-EBI.
{ Web Apollo A Web-based Genomics Annotation Editing Platform Ed Lee, Gregg Helt, Justin Reese, Monica Munoz-Torres*, Christopher Childers, Rob Buels,
Abstract Although transposable elements (TEs) were discovered over 50 years ago, the robust discovery of them in newly sequenced genomes remains a difficult.
Comparative Genomics Tools in GMOD GMOD.org Dave Clements 1, Sheldon McKay 2, Ken Youns-Clark 2, Ben Faga 3, Scott Cain 4, and the GMOD Consortium 1 National.
The GMOD Project: Creating Reusable Software Components for Genome Data Scott Cain GMOD Project Coordinator Cold Spring Harbor Laboratory.
Gramene’s Outreach Program. Outreach Components Workshops Website Improvements / Additions Public Announcements High School Outreach Collaborators and.
The Hymenoptera Genome Database (HGD, is an informatics resource supporting genomics of hymenopteran insect species. It currently.
Copyright OpenHelix. No use or reproduction without express written consent1.
Andy Conley 3/26/ James Kent. Know that name. He is one of greatest, perhaps the greatest, bioinformatics programmers ever. He was deeply involved.
WebApollo: A Web-Based Sequence Annotation Editor for Community Annotation Ed Lee, Gregg Helt, Nomi Harris, Mitch Skinner, Christopher Childers, Justin.
WebApollo extending JBrowse to support DAS & genomic annotation editing Gregg Helt, Ed Lee, Nomi Harris, Mitch Skinner, Suzanna Lewis, Ian Holmes Lawrence.
GMOD Help Desk Dave Clements. GMOD Help Desk What I've been doing What I'm planning on doing What should I be doing? How am I doing?
NCBI Vector-Parasite Genomic Related Databases Chuong Huynh NIH/NLM/NCBI Sao Paulo, Brasil July 12, 2004
Web Apollo and the VectorBase user community Gloria I. Giraldo-Calderón March 31, 2015.
GMOD: Managing Genomic Data from Emerging Model Organisms Dave Clements 1, Hilmar Lapp 1, Brian Osborne 2, Todd J. Vision 1 1 National Evolutionary Synthesis.
Bioinformatics. Sequence information Mapping information Phenotypic information Literature Prediction programs -Gene prediction -Promotor prediction -Functional.
Browsing the Genome Using Genome Browsers to Visualize and Mine Data.
Got genom e? Community Meetings GMOD.org The GMOD community meets semi- annually to discuss GMOD components, best practices,
VectorBase: Outreach! VectorBase: Outreach! Courses & Demos Seminars & Talks at meetings Courses & Demos Seminars & Talks at meetings.
VectorBase BRC The evolving VectorBase gene build: mixing automated and manual approaches when annotating vector genomes Daniel Lawson VectorBase-EBI,
Vectorbase and Galaxy Jarek Nabrzyski On behalf of VectorBase Center for Research Computing University of Notre Dame VectorBase Bioinformatics Resource.
24th Feb 2006 Jane Lomax GO Further. 24th Feb 2006 Jane Lomax GO annotations Where do the links between genes and GO terms come from?
GMOD Meeting August 6-7, 2009 Oxford, UK Scott Cain, PhD. GMOD Project Coordinator Ontario Institute for Cancer Research
August 2008Bioinformatics Tools for Comparative Genomics of Vectors1 Genomes Daniel Lawson EBI.
Map-based Exploration of Population Biology Data in VectorBase What is VectorBase? We are a consortium of institutions that hosts the genomes of invertebrate.
5/8/06 Scott Cain Stein Lab Retreat, 2006 GMOD Update Progress since last year  Software releases  Notable new users  Schema enhancements  New GMOD.
A collaborative tool for sequence annotation. Contact:
What's new with GMOD Scott Cain GMOD Coordinator
GBrowse: Generic Genome Browser May 2003 Update Lincoln Stein, CSHL.
Lei Kong, Ph.D. Center for Bioinformatics Peking University ABrowse - A General Purpose Genome Browser Framework.
GMOD Meeting San Diego January 15-16, 2009 Scott Cain GMOD Project Coordinator Ontario Institute for Cancer Research.
The State of GMOD March 2011 GMOD Meeting US National Evolutionary Synthesis Center (NESCent) 5 March 2011 Sponsored by Scott Cain GMOD Project Coordinator.
The Bovine Genome Database Abstract The Bovine Genome Database (BGD, facilitates the integration of bovine genomic data. BGD is.
Canadian Bioinformatics Workshops
Galaxy for analyzing genome data Hardison October 05, 2010
02/20/14 Mining Genomes - Tools of the Trade.
Behavior and Phenotype in GMOD Natural Diversity in GMOD
VectorBase genome annotation
Genome Browsers.
Daphnia Genome Preview at wFleaBase.org
Bioinformatics Research Group
GEP Annotation Workflow
The Celera Genome Browser: A Tool for Visualizing and Annotating the Human Genome
GBrowse-related work at ApiDB
GO Annotation from different sources
got genome? Community Meetings Databases Training GMOD.org
Plant and Animal Genome XIX
Plant and Animal Genome XVIII
TAMU Bovine QTL db and viewer
2 Unité de Biométrie et d’Intelligence Artificielle (UBIA) INRA
Part II SeqViewer AraCyc Help
Presentation transcript:

Bioinformatics Tools for Comparative Genomics of Vectors Genome Browsers August 2008 Bioinformatics Tools for Comparative Genomics of Vectors

Bioinformatics Tools for Comparative Genomics of Vectors Artemis Annotation platform used by Sanger Institute Pathogen group Can be used as a visualization tool Capable of reading EMBL/GenBank and GFF files Built in database entry fetching facility Designed for bacterial genomes Used for small eukaryotes Limited use for larger, heavily spliced genomes http://www.sanger.ac.uk/Software/Artemis/v10/ August 2008 Bioinformatics Tools for Comparative Genomics of Vectors

Bioinformatics Tools for Comparative Genomics of Vectors GBrowse Developed by Lincoln Stein (CSHL/Toronto) Very flexible Works with flat files, GFF databases, CHADO RDBs and via adaptors from EMBL/GenBank files Users include PlasmoDB, FlyBase and WormBase. http://gmod.org/wiki/index.php/Gbrowse August 2008 Bioinformatics Tools for Comparative Genomics of Vectors

Bioinformatics Tools for Comparative Genomics of Vectors Ensembl Bespoke browser from the Ensembl group Many different display pages for a variety of data types Users include Ensembl, VectorBase, Gramene http://www.ensembl.org/index.html August 2008 Bioinformatics Tools for Comparative Genomics of Vectors

Bioinformatics Tools for Comparative Genomics of Vectors Apollo Annotation platform used by FlyBase and TAIR groups. Developed through Berkeley/EBI/GMOD. Can be used as a visualization tool Capable of reading CHADO-XML and GFF files Adaptors for CHADO RDB and Ensembl databases http://gmod.org/wiki/index.php/Apollo August 2008 Bioinformatics Tools for Comparative Genomics of Vectors

Bioinformatics Tools for Comparative Genomics of Vectors Artemis exercises August 2008 Bioinformatics Tools for Comparative Genomics of Vectors