Get out worksheet from yesterday and Nucleotides Combine the nucleotides of your choice to create one strand of DNA Then create the compliment strand of DNA Compare your strand to your to your neighbors strand and finish the worksheet.

Protein Synthesis Warm Up What is a code? How does a code work? What do you think “genetic code” means?

RNA vs. DNA RNA DNA ribose sugar nitrogen bases single stranded G, C, A, U U : A C : G single stranded Found inside & outside the nucleus DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded Only found inside the nucleus

Based on what you know about DNA and RNA, describe what you see happing to the DNA molecule in the image to the left.

Protein Synthesis Protein Making

Goal Understand the Overall process of protein synthesis (transcription + translation) Know the Roles DNA mRNA tRNA

Organelles used in Protein Synthesis

Protein Synthesis is the process (steps) of sharing the information in the genes of DNA out of the nucleus to the ribosomes to create proteins, which create your traits

Protein Synthesis DNA can’t get out! cytoplasm build proteins mRNA Read DNA blueprint Create a (single strand) mRNA copy Leave Nucleus Goes to Ribosome (cytoplasm) Ribosome reads RNA tRNA brings amino acid Ribosome combines amino acids cytoplasm nucleus DNA can’t get out! build proteins mRNA ribosome

Draw this in your spiral Cell Ribosome DNA mRNA protein trait nucleus

Draw this in your spiral Cell Ribosome DNA mRNA protein trait nucleus

Protein Synthesis Story Time It was Christmas time in the land of Celltopia. There was a princess stuck in her Nucastle because of a broken foot. She really wanted a the gift of blonde hair and green eyes, but she would never make it in time to Santa’s Ribo factory!! So she came up with the idea to write her Christmas list down and give it to her guard. The guard took off with her list on his horse to find one of Santa’s elves who worked in the ribo-facotry and he immediately began reading her list and producing her blonde hair present, and green eye present. On Christmas morning the princess woke up and opened her presents, “yay!!!!” she exclaimed, she now had blonde hair and green eyes!!

Correctly Match the photos from the story to your diagram. Cell Ribosome DNA mRNA protein trait nucleus

From nucleus to cytoplasm transcription translation DNA mRNA protein trait nucleus cytoplasm

First Step - Transcription DNA mRNA First Step - Transcription Transcribes DNA to mRNA DNA strand is the template (pattern) match bases U : A G : C mRNA leaves nucleus into cytoplasm

2nd Step – Translation mRNA to protein mRNA converted to protein shapes in the ribosome Ribosome read 3 nitrogen bases at a time Codon: 3 nitrogen bases creates 1 amino acid tRNA brings the amino acid Rib

Protein Synthesis = Transcription + Translation https://www.youtube.com/watch?v=gG7uCskUOrA

Get out the Diagram from Friday In your table groups complete the transcription translation diagram

Check Point! Match the analogies to the appropriate biological structure. The Blueprint The instructions The reader The transporter Word Bank DNA tRNA Ribosome mRNA DNA (blueprint) provides the information, the mRNA (instructions) copies the message, the ribosome (reader) de codes the message, and the tRNA (transporter) brings one amino acid to the ribosome over and over again to build a protein.

Answer the following questions Name the two steps of protein synthesis (in order). What is the role of DNA in protein synthesis? What is the role of mRNA? What is the role of tRNA (use the word amino acid &protein)? How is DNA transcribed? During translation, how does mRNA produce proteins?

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U instead of T is matched to A C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

cytoplasm protein nucleus ribosome U C A G trait

The mRNA code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

DNA mRNA protein trait From gene to protein tRNA transcription aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

Protein Synthesis Activity!!

From gene to protein protein transcription translation