DNA The Genetic Material The Genetic Material

Sections DNA Structure DNA Replication DNA Transcription DNA Translation Mutations Gene Expression

DNA is a BIG, intricately packaged molecule.

What is DNA? DNA is the double stranded, helical nucleic acid that stores hereditary information.

What is the Structure of DNA?

What are “Nucleotides?” The subunits within DNA which are attached to the ribose/phosphate “backbone.”

DNA Structure

Chromosome Structure

Histone

Chromosome number chromosomes. ( Humans have 46) All Species have a specific number of chromosomes. ( Humans have 46) Humans and animals have 2 types. Sex chromosomes - determine sex of the animal. (Humans have X and Y - XX female XY male.) Autosomes- All other chromosomes

DNA Structure

Bonding in DNA…

Model Key Adenine (J) Thymine (E) Cytosine (G) Guanine (F) Deoxyribose sugar (A) Phosphate (C) ATTGATGCGCAC

BUILD THIS! ATTGATGCGCAC

DNA Replication A single strand of DNA serves as a template for a new strand. The rules of base pairing direct replication. Each body cell gets a complete set of identical DNA.

Replication is a 3 Step Process Step 1: The two Original DNA strands separate with help from “DNA Helicase” enzymes which “unzip” the helix.

A 3 Step process… Step 2: “DNA Polymerase” enzymes recognize specific “Origins of replication” sequences and begin adding complementary nucleotides to each strand.

The “Magic” of “DNA Polymerase”…

The Final Step Step 3: Two identical DNA molecules are finally formed from the original and the enzymes detach.

Errors in Replication… Nearly 50 different enzymes play a role in ensuring that bases are not misplaced or mismatched in the replication process, thus limiting genetic mutations. DNA Polymerase will not replicate a “mismatched Nucleotide” thus limiting genetic mutations.

Multiple Replication Forks Because chromosomes are so large, (billions of base pairs) multiple “replication forks” or bubbles work simultaneously to facilitate replication in about 9 hours.

The Central Dogma: DNA Transcription and Translation ?

Key Question: How do cells go from a master “blueprint” (the genetic code) to specialized proteins?

The Central Dogma Transcription Translation

Transcription: Step 1 Tightly packaged DNA must be unraveled and unwound by helicase enzymes inside the cell nucleus.

Transcription: Step 1 (cont.) Helicase enzymes are highly intricate and specialized in different types of cells. They are designed to recognize and unwind only certain sections of DNA in various cells depending on what proteins need to be constructed in that particular cell.

For example: Cells at the base of a hair follicle transcribe and translate genes coding for the production of a protein called “Keratin.”

Transcription: Step 2 A complex of RNA polymerase enzymes recognize portions of the DNA that will be ‘copied.’ A single stranded copy is made called an mRNA transcript. RNA forms base pairs with DNA C pairs with G A pairs with U

mRNA vs DNA: Key Differences Single stranded Ribose sugar Bases: C,G,A,U DNA Double stranded Deoxyribose sugar Bases: C,G, A,T

DNA Transcription

DNA Transcription

Transcription Challenge Transcription Challenge! Create an mRNA transcript for the following DNA sequence. ACGATACCCTGACGAGCGTTA UGC UAU GGG ACU GCU CGC AAU Hmmmm…

Transcription: Step 3 After it is initially copied, the mRNA transcript is not yet complete. ‘Splicing’ enzymes recognize coding regions (exons) and non-coding regions (introns). Introns must be removed before the completed transcript can leave nucleus.

Transcription Animation

Transcription is Complete… What’s Next? How is mRNA “read” to generate proteins from Amino Acids? The mature mRNA transcript exits the nucleus through a nuclear pore. Once in the cytoplasm, it seeks out a ribosome to begin Translation.

Ribosomes Ribosomes are referred to as rRNA and act as the site for translation. Composed of 2 subunits (large and small), separate in cytoplasm until they ‘clamp down’ on an mRNA transcript. Large subunit contains 3 binding sites called E, P, and A, respectively.

tRNA- ‘The Essential Link’ Transfer RNA ‘delivers’ the proper amino acid to the ribosome by ‘reading’ the mRNA transcript in sets of 3 bases called “codons”. Bound to one of 20 different amino acids on one end On the other end Anticodon complements mRNA codon

The Key to the Code: Which codons code for which amino acids?

Translation: Initiation Can you finish labeling this diagram by finding the: tRNA molecule amino acid codon anti-codon fMet UAC A E Large subunit P GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’ mRNA 3’ Small subunit

Translation Initiation Animation

Translation - Elongation Phe Leu Met Ser Gly Polypeptide CCA UCU Arg Aminoacyl tRNA A E Ribosome P GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’ mRNA 3’

Translation – Elongation (cont.) What portion of this complex will eventually become a ‘baby’ protein? Phe Leu Met Ser Gly Polypeptide Arg CCA UCU tRNA A E Ribosome P GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 5’ mRNA 3’

Translation Elongation Animation

Translation: Termination When a tRNA recognizes one of 3 “STOP” codons (see key), proteins called release factors cause the ribosome, the mRNA, and the new polypeptide to disassociate. The new polypeptide is complete. Note the untranslated region beyond the STOP codon.

Translation Termination Animation

The Polypeptide Made up of a string of thousands of amino acids 20 amino acids are arranged in different orders to make a variety of proteins

Amino Acids: The Building Blocks

Amino Acids: The Building Blocks

Review: the Central Dogma A gene is a segment of DNA that brings about transcription of a segment of RNA

Transcription vs. Translation: A Comparison Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Key enzyme complex is RNA polymerase Translation Process by which information encoded in mRNA is used to assemble a protein Occurs on a Ribosome (rRNA) mRNA protein Involves tRNA, and amino acids

Errors in Transcription: Mutations Mutations are errors in the replication (and subsequently transcription/translation) process. Mutations most likely have no effect whatsoever on the organism. In gamete formation, mutations can potentially have either a positive or negative effect on the organism

Types of Mutations: The Point mutation Example: The fat cat ate the wee rat. The fat hat ate the wee rat. A point mutation is a simple change in one base of the gene sequence. This is equivalent to changing one letter in a sentence. Point mutations rarely change a protein enough to make a noticeable difference.

Did you Know?... Sickle Cell Anemia results from a point mutation on the gene coding for hemoglobin, an important and complex protein found on red blood cells.

Types of Mutations: The Frame Shift Mutation Deletion In a frame shift mutation, one or more bases are inserted or deleted, the equivalent of adding or removing letters in a sentence. This type of mutation can make a transcript meaningless and often results in a shortened protein. Example: when the 't' from cat is removed, but we keep the original letter spacing: The fat cat ate the wee rat. The fat caa tet hew eer at.

Types of Mutations: Chromosomal Mutations During mitosis and/or meiosis, entire portions of chromosomes can sometimes be lost, inverted, or translocated. When this occurs in gamete formation, genetic disorders often result.

Gene Regulation Key Question: “How does a cell know what proteins to make?” Regions within DNA called “operators” and “promoters” initiate the transcription process. Specialized enzymes within cells called “repressors,” and “activators” bind to these sequences of DNA and either initiate, or inhibit transcription. (respectively)

Gene Regulation (cont.)

That’s All Folks!