“How does it affect the protein?”

Slides:

Advertisements

Similar presentations

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

Advertisements

 Genetic Mutations Accelerated Biology. What is a Mutation?  A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA.

GENE EXPRESSION & MUTATIONS IN DNA

DNA Mutations. Victims of Chernobyl - Mutations What are mutations? Mutations are a change in the genetic material of a cell (i.e. the genes).

Mutations Chapter 12.4.

Mutations. DNA Mistakes DNA is a molecule that replicates, works and copies with very high accuracy DNA has enzymes that make sure that it works with.

Gene Mutations Chapter 11.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Using a Codon Chart & Mutations Today’s Goal: Review codons and anticodons and describe several types of mutations. Quiz tomorrow over ch 12 and 13 material.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

Point Mutations Silent Missense Nonsense Frameshift.

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

DNA (Gene) Mutations. What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect.

Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations 12–4 Mutations.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Ch. 9.7 Mutations Every once in a while, cells make mistakes in copying their own DNA An incorrect base can be inserted or sometimes a base is skipped.

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Mutations: Definition: Changes in DNA in an organism. These changes can be problematic, can be helpful, or can have no effect. Mutations are what DRIVES.

Wednesday March 22, 2017 I can: Agenda Catalyst HW: IP: Mutations

DNA/GENE MUTATIONS.

Gene Mutations.

Gene Mutations.

Types of Mutations.

Gene Mutations Chapter 11.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Mutations (Ch. 17).

Mutations TSW identify and describe the various types of mutations and their effects.

Mutations changes in the DNA sequence that can be inherited

A mutation is a change in an organism’s DNA.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

Do Now What is the central dogma of biology?

Some mutations affect a single gene, while others affect an entire chromosome.

mutation = change in an organism’s DNA.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations Section 12-4 Pages

Mutation: Some Definitions

Mutation Notes.

Copyright Pearson Prentice Hall

Mutations (Ch. 17).

Mutations Notes.

Mutations The fat cat sad.

DNA (Gene) Mutations.

Gene Regulation and Mutations

Mutations: Changes in Genes

Gene Mutations.

Presentation transcript:

“How does it affect the protein?” Mutations in DNA “How does it affect the protein?”

ID the mutation as either: Substitution Insertion Deletion Remember, this is a CHANGE to the original DNA sequence!

Identify the type of mutation that has occurred: Original  ATC TTA GGC CGA New  ATC TAA GGC CGA ANSWER : Substitution

Identify the type of mutation that has occurred: Original  ATCTTAGGCCGA New  ATTAAGGCCGA C ANSWER : Deletion

Identify the type of mutation that has occurred: Original  ATCTTAGGCCGA New  ATCTTAGAGCCGA ANSWER : Insertion

Identify the type of mutation that has occurred: Original  ATCTTAGGCCGA New  ATCTATAGGCCGA ANSWER : Insertion

There are FIVE results that can occur DUE to a mutation: Silent mutation  Protein unaffected Substitution  One amino acid substituted Premature stop  STOP coded too early and protein is left short Codon deletion or insertion  ONE amino acid is added in or removed from protein Frame shift mutation  When a simple insertion or deletion changes the entire sequence of amino acids

Identify the type of mutation that has occurred: Original  ATGTTAGGCCGA New  ATGTATAGGCCGA Identify the ORIGINAL protein and NEW protein. What resulted from this insertion? FRAMESHIFT

Identify the type of mutation that has occurred: Original  ATG TTA GGC CGA New  ATG TTA GGC CGG Determine both Original and NEW proteins Substitution – What results from this? SILENT MUTATION

Identify the type of mutation that has occurred: Original  ATGTTGATAGGA New  ATGTTGATTGGA What results from this Substitution? Premature STOP