Prof.Dr. Mohammed H.Khudor Prof.Dr.Basil A.Abbas Occurrence of fungi in poultry feed with cultural and molecular detection of their aflatoxigenic activity M.Sc. Student Raed Najeeb Kadhim Supervisors Prof.Dr. Mohammed H.Khudor Prof.Dr.Basil A.Abbas

Mycotoxins Low-molecular-weight natural products produced as secondary metabolites by fungi. Lack of visible appearance of fungus does not negate presence of mycotoxins. Toxins can remain in the organism after fungus has been removed. Mycotoxins greatly resist decomposition and even temperature treatments, such as cooking and freezing. Resistant to breakdown in an animal’s digestive system.

Some important toxigenic fungi Aspergillus Toxigenic fungi Penicillium Fusarium Alternaria

Aspergillus Found in soil, plant debris, and indoor air environment Aspergillus flavus is The most important species which cause aspergillosis in animals as well as in man and in birds. Aspergillus flavus causes mycotic abortion in cattle and sheep.Ingestion of high amounts of aflatoxin may induce lethal effects, also cause sinusitis, cerebral aspergillosis, meningitis, pulmonary aspergillosis, cutaneous aspergillosis and hepatosplenic aspergillosis. Produces many toxins as aflatoxins (B1, B2, ,G1,G2, M1,  M2) Gliotoxin, Sterigmatocystin,  and Methoxy Sterigmatocystin.

Some important mycotoxins Today 300 - 400 mycotoxins are known Common mycotoxins Ochratoxin Fumonisin Aflatoxin Deoxynivalenol Zearalenone

Produced by Aspergillus. flavus, A.parasiticus and A. oryzae. Aflatoxins Produced by Aspergillus. flavus, A.parasiticus and A. oryzae. There are types: aflatoxins B1 (AFB1) and B2(AFB2),G1(AFG1),G2(AFG2),M1(AFM1) andM2(AFM2). Aflatoxin B1 occurs most frequently and is most toxic and carcinogenic.

Method

Collection of samples of poultry feed Culturing on PDA,MEA& SDA Isolation Identification A. flavus Morphological by culture Microscopically Molecular Cultural method (on CAM medium Light Microscope PCR Sequences analysis UV NH4 Sol.

The Aim of Study 1 Study the occurrence of mycoflora in poultry feed. Determination of aflatoxigenic A.flavus. Compatible homology aflatoxigenic A.flavus strains with other strains in the gene bank.

Results 1- Morphological and microscopic identification

Aspergillus Penicillium Figure(1)

Rhizopus Chladosporium Figure(2)

Mucor Alternaria Figure(3)

Fusarium Figure(4)

A.flavus A.niger Figure(5)

A.fumigatus A.terreus Figure(6)

A.flavipes A.carbonarius Figure(7)

A.ochraceus A.candidus Figure(8)

A.parasiticus Figure(9)

Calculation of frequency and relative density of genera and Aspergillus spp.

Table(1):Range and average count cfu/g of recovered molds genera from poultry feed samples

Table(2):Frequency and relative density of recovered mold genera from poultry feed samples.

Table(3):Range and average count cfu/g of recovered Aspergillus spp Table(3):Range and average count cfu/g of recovered Aspergillus spp. from poultry feed samples

Table(4):Frequency and relative density of recovered Aspergillus spp Table(4):Frequency and relative density of recovered Aspergillus spp. from poultry feed samples

2- Cultural detection a-UV light

Control Control Non aflatoxigenic Aflatoxigenic Figure(10)

b-Ammonia vapor

Control Figure(11)

3-Molecular by PCR

Figure(12): Agarose gel electrophoretic of PCR products obtained from DNA of fungal isolates showing amplicons for aflR primer. Lanes: M- 100bp standard, Lanes1–7: A. flavus (aflatoxin producer) amplicon corresponding to 798 bp.

Table(5):Detection of aflatoxigenic and nonaflatoxigenic A Table(5):Detection of aflatoxigenic and nonaflatoxigenic A.flavus isolates from poultry feed by three methods 16

Sequencing analysis of PCR product

Conclusions 1-There were contamination with aflatoxin in poultry feed in farms and local markets in Basrah governorate. 2- There are several fungi in collected poultry feed . 3-Several identification and detection methods o aflatoxigenic Aspergillus flavus were used , the most specific , powerful and accurate methods were molecular methods (PCR and sequences analysis) .These two methods detect the specific gene and genetic sequences which produce the aflatoxin.

Conclusions 4- The sequences analysis revealed that the poultry feed were contaminated with aflatoxigenic A.flavus isolates , and these isolates were compatible(100% and 99%) with other A.flavus strains in gene bank.

Recommendations 1- Deep study should be done on mycotoxigenic fungi and the amount of mycotoxin in several farms storage and local markets in Basrah governorate. 2- Control and prevent factors such as moister and temperature which play important role in fungal growth and mycotoxin production by make them unsuitable .

Recommendations 3- Bioassay is very important measurement in this type of studies, so it is recommended to held more deep studies to estimate the effect of degradation residues on domestic animals especially blood parameters and status. 4- Application of biocontrol agent as a powerful control factor for aflatoxins especially the aflatoxin B1( AFB1).

CATCTATTCACACCCACACGGCTCTGCCCACCCCGAATGGTAGCAGTAGCGTCTCCGCCATCTTTTCTCATCAGAGTCCGCCGCCACCCGTGGAGACCCAGGGCCTTGGAGGAGATCTGGCTGGTCAGGAGCAAAGCACCCTGTCTTCCCTAACAGTCGATTCGGAATTCGGGGGCTCGTTGCAGTCAATGGAACACGGAAACCATGCCGATTTCTTGGCCGAGTCGACGGGGAGTCTTTTCGACGCGTTTTTGGAAGTAGGGACCCCCATGATCGACCCGTTCCTCGAGTCGGCCCCACTACCACCGTTTCAGGCGCGCTATTGCTGCTTTTCGCTAGCACTACAAACACTGACCCACCTCTTCCCCCACGCCCCGCTGGGCTGTCAACTACGGCTGACGGACGGTGAGGACAGTTCGTACAACCTGATGACGACTGATATGGTCATCTCGGGGAACAAGAGGGCTACCGATGCGGTCCGGAAGATCCTCGGGTGTTCGTGCGCGCAGGATGGCTACTTGCTGAGCATGGTCGTCCTTATCGTTCTCAAGGTGCTGGCATGGTATGCTGCGGCAGCAGGCACCCAGTGTACCTCAACGGCGGCGAGTGGAGAAACCAACAGTGGCAGCTGTAGCAACAGTCCCGCCACCGTGTCCAGTGGCTGTCTGACGGAAGAGCGCGTGCTGCACCTCCCTAGTATGGTGGGCGAGGATTGTGTGGATGAGGAAGACCAGCCGCGAGTGGCGGCACAGCTTGTTCTGAGCGAACTGCACTATTATGTTCTTTTATTTTTGTTGTTGCTCTTAGTCTGCGTTCTCTGTGTCTCTTATCTGTGGAGTGTATTATT

GGAGGGTTCCCTCGCGGGCTGGTCTTCTCATCCACACAATCCTCGCCCACCATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGACTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTGCCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGCAAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTCTTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCCGTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCAGTGTTTGTAGTTCTATATAATCTTTATTTATATATTCTTTTATTTGTCTATATTGTAGATTTTTTTTATTTTTTATTCTTTCTTTTTTATAATATACTTTTTTTT

AGGGGGGGGGGGAATTGATCGCGGCTGGTCTTCTCATCCACACAATCCTCGCCCACTCATACTAGGGAGGTGCAGCACGCGCTCTTCCGTCAGACAGCCACTGGACACGGTGGCGGGACTGTTGCTACAGCTGCCACTGTTGGTTTCTCCACTCGCCGCCGTTGAGGTACACTGGGTGCCTGCTGCCGCAGCATACCATGCCAGCACCTTGAGAACGATAAGGACGACCATGCTCAGCAAGTAGCCATCCTGCGCGCACGAACACCCGAGGATCTTCCGGACCGCATCGGTAGCCCTCTTGTTCCCCGAGATGACCATATCAGTCGTCATCAGGTTGTACGAACTGTCCTCACCGTCCGTCAGCCGTAGTTGACAGCCCAGCGGGGCGTGGGGGAAGAGGTGGGTCATTTTTTGTTTTATTTGCGAATTTCTGTAATTTCGTTCCTGTTAAGGTCGTTTATTTTTTGTTGTACTATTTCTTTTCTTTTATTCTGATTTGTTTTTT