from nucleic acid language to amino acid language

Slides:



Advertisements
Similar presentations
From Gene to Protein How Genes Work
Advertisements

From Gene to Protein Chapter 17 - Campbell.
DNA gets all the glory, but proteins do all the work!
Protein Synthesis Notes
From Gene to Protein.
From Gene to Protein Chapter 17 - Campbell What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
MCC BP Based on work by K. Foglia Chapter 17. From Gene to Protein.
AP Biology Lecture #33 Translation.
From Gene to Protein How Genes Work
AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?
AP Biology From Gene to Protein How Genes Work.
AP Details for Protein Synthesis 2014 From gene to protein.
AP Biology Chapter 17. From Gene to Protein.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
Protein Synthesis.
Regents Biology From gene to protein: transcription translation protein.
From Gene to Protein proteinscellsbodies How does DNA code for cells & bodies? DNA.
D.N.A 1. The information carried by a DNA molecule is in
AP Biology Chapter 17. From Gene to Protein.
From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
Chapter 17: From Gene to Protein
From Gene to Protein How Genes Work (Ch. 17).
From gene to protein DNA mRNA protein trait nucleus cytoplasm
Chapter 17~ From Gene to Protein
Ch 10: Protein Synthesis DNA to RNA to Proteins
Chapter 17~ From Gene to Protein
From Gene to Protein How Genes Work
Reading the instructions and building a protein!
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work.
Translation Unit 5B.4.
Chapter 17~ From Gene to Protein
From Gene to Protein How Genes Work
Ch 17 - From Gene to Protein
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein Chapter 17.
From Gene to Protein.
From Gene to Protein Chapter 17 - Campbell.
From Gene to Protein How Genes Work
from nucleic acid language to amino acid language
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
Reading the instructions and building a protein!
Transcription Credit for the original presentation is given to Mrs. Boyd, Westlake High School.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein Chapter 17 - Campbell.
Figure 17.1 Figure 17.1 How does a single faulty gene result in the dramatic appearance of an albino deer?
Protein Synthesis Making Proteins
From Gene to Protein How Genes Work
An introduction to biotechnology
Chp.17 From Gene to Protein How Genes Work
From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
from nucleic acid language to amino acid language to PROTEIN language
From Gene to Protein Chapter 17 - Campbell.
Presentation transcript:

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

? TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC mRNA codes for proteins in triplets called codons: Each codon calls for 1 amino acid TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

Wobble? What is wobble?

How are the codons matched to amino acids? tRNA finds the correct amino acid that responds to the codon and brings it to the ribosome 3 5 DNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 5 3 mRNA codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

The Transcriptional unit (gene?) enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start UTR introns transcription stop UTR promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA

Protein Synthesis in Prokaryotes Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall 2007-2008

Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

What color would a smurf turn if he held his breath? Any Questions?? What color would a smurf turn if he held his breath? 2007-2008