Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs.

Slides:

Advertisements

Similar presentations

This is a template, please replace this with your data This file is at a 4 x 3 resolution This file has a 10 slides On the first slide of your presentation.

Advertisements

The Build-up of the Red Sequence at z

Slide 1Fig. 22.1, p.669. Slide 2Fig. 22.3, p.670.

Slide 1Fig. 17.1, p.513. Slide 2Table 17.1, p.514.

RNA Structure Prediction

Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.

Where Will They Strike Next? microRNA targeting tactics in the war on gene expression Jeff Reid Miller “Lab” Baylor College of Medicine.

A convenient system for highly specific and sensitive detection of miRNA expression Xiangqi Li, Minjie Ni, Chaobao Zhang, Wubin Ma, Yonglian Zhang SUPPLEMENTAL.

 decimals/cc-7th-fracs-to-decimals/v/converting-fractions-to-decimals-example.

MicroRNA identification based on sequence and structure alignment Presented by - Neeta Jain Xiaowo Wang†, Jing Zhang†, Fei Li, Jin Gu, Tao He, Xuegong.

Computational Identification of Drosophila microRNA Genes Journal Club 09/05/03 Jared Bischof.

ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.

Supplemental Data Fig. 1A. Standard curves of miR-34c-5p using synthetic miRNAs.

 Read quality  Adaptor trimming  Read sequence collapse Preprocessing Genome mapping  Map read to the spruce genome (Pabies1.0- genome.fa) using Patman

MicroRNAs and Other Tiny Endogenous RNAs in C. elegans Annie Chiang JClub Ambros et al. Curr Biol 13:

Supplementary data Modulatory role of mineral nutrients on cadmium accumulation and stress tolerance in Oryza sativa L. seedlings Abin Sebastian a, M.

Copyright OpenHelix. No use or reproduction without express written consent1.

Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine 朱林娇 14S

MicroRNA Prediction with SCFG and MFE Structure Annotation Tim Shaw, Ying Zheng, and Bram Sebastian.

Abstract Premise Figure 1: Flowchart pri-miRNAs were collected from miRBase 10.0 pri-miRNAs were compared to hsa and ptr genomes using BlastN and potential.

Growth factor PI3K PDK1/2 PIP 3 AKT CASP9 FOXO1 BAD CDKN1A CDKN1B MDM2 GSK3B CHUK mTOR PTEN miR-26ab/1297; miR-148/152; miR-103/107; miR-19; miR-425/489;

Identification of Novel Genes Coding for Small Expressed RNAs Kang Haiqi From: Science :

Figure S1 cmSP165/166 severe b MIM159 (mir159a) a Figure S1: Detailed phenotype of severe cmSP165/166 and MIM159 plants. Severe cmSP165/166 (15x) plants.

Author(reference) down up Supplemental data S1. differentially expressed miRNAs in selected microarray studies Murakami (14)miR-18, miR-224miR-199a, miR-195,

Figure 1. miRNA processing and primer design

Identifying Conserved microRNAs in a Large Dataset of Wheat Small RNAs

Oncogene activation Transcription DNA damage MDM2 CDKN2A MDM4 p53 ATR

Figure 1. drb7.2 mutant plants display altered accumulation of endoIR-siRNA. Wild-type (Col-0) and drb7.2 mutant plants were subjected to high throughput.

A Strategy to Find Suitable Reference Genes for miRNA Quantitative PCR Analysis and Its Application to Cervical Specimens Iris Babion, Barbara C. Snoek,

Step 1: amplification and cloning procedures

אוניברסיטת בר אילן פרוייקט גמר- ביולוגיה חישובית

Amino‐acid sequence of the heterogeneous nuclear RNP G protein family and RNA‐binding SELEX consensus sequence obtained for human RBMY. (A) Sequence alignment.

Volume 8, Issue 2, Pages (February 2015)

MicroRNAs of rat articular cartilage at different developmental stages identified by Solexa sequencing J. Sun, N. Zhong, Q. Li, Z. Min, W. Zhao, Q. Sun,

MiR‐199a directly targets ERBB2 and ERBB3, whereas miR‐125b targets ERBB3. miR‐199a directly targets ERBB2 and ERBB3, whereas miR‐125b targets ERBB3. (A)

Volume 15, Issue 8, Pages (April 2005)

Volume 13, Issue 1, Pages (July 2007)

Signatures of Purifying and Local Positive Selection in Human miRNAs

Volume 7, Issue 1, Pages (January 2014)

Gracjan Michlewski, Sonia Guil, Colin A. Semple, Javier F. Cáceres

Cell-Type-Based Analysis of MicroRNA Profiles in the Mouse Brain

A Two-Hit Trigger for siRNA Biogenesis in Plants

Volume 17, Issue 3, Pages (October 2016)

Volume 22, Issue 2, Pages (January 2012)

Volume 18, Issue 10, Pages (May 2008)

For First Place Most Times Up at the Table

Volume 8, Issue 6, Pages (September 2014)

Figure 4. Differentially expressed miRNAs and isomiRNAs between different pairs of tissues The differentially expressed miRNAs and their isomiRNAs are.

AGO1 Homeostasis Entails Coexpression of MIR168 and AGO1 and Preferential Stabilization of miR168 by AGO1 Hervé Vaucheret, Allison C. Mallory, David.

Novel p53 target genes identified by RNA-Seq, pSILAC and ChIP-Seq.

Volume 26, Issue 2, Pages e4 (January 2019)

Volume 116, Issue 2, Pages (January 2004)

Matthew W Jones-Rhoades, David P Bartel Molecular Cell

Volume 9, Issue 9, Pages (September 2016)

Prediction of Plant MicroRNA Targets

Molecular Therapy - Nucleic Acids

Baekgyu Kim, Kyowon Jeong, V. Narry Kim Molecular Cell

MicroRNA Processing: Battle of the Bulge

Molecular Therapy - Nucleic Acids

CARPEL FACTORY, a Dicer Homolog, and HEN1, a Novel Protein, Act in microRNA Metabolism in Arabidopsis thaliana Wonkeun Park, Junjie Li, Rentao Song,

Both Natural and Designed Micro RNAs Can Inhibit the Expression of Cognate mRNAs When Expressed in Human Cells Yan Zeng, Eric J Wagner, Bryan R Cullen

Volume 120, Issue 1, Pages (January 2005)

Volume 37, Issue 3, Pages (May 2016)

Specific Effects of MicroRNAs on the Plant Transcriptome

dsRBDs 3 and 4 of hStau1 are sufficient for ARF1 SBS binding.

Volume 11, Issue 8, Pages (August 2018)

Figure 1. Workflow of the analysis to estimate the number of true human miRNAs. Samples containing NGS data were ... Figure 1. Workflow of the analysis.

A Structural Bisulfite Assay to Identify DNA Cruciforms

Liang Song, Michael J. Axtell, Nina V. Fedoroff Current Biology

Volume 4, Issue 1, Pages (January 2011)

Presentation transcript:

Additional file 5 Novel and conserved miRNAs in the halophyte Suaeda maritima identified by deep sequencing and computational predictions using the ESTs of two mangrove plants Corresponding author e-mail: sachingharat113@gmail.com Following slides: Stem-loop secondary structure of precursors of the novel and conserved miRNAs. The red and green arrows indicate miRNA and miRNA* sequences, respectively. The values in the tables against the individual precursors were obtained by miRDeep2.

mir1, S. maritima mir1, R. mangle -miR1: AATAGGTACTGTAACTGGTATT Total number of reads matching the sma-mir1 precursor 149 Mature sma-miR1 read count 24 Percentage of reads corresponding to mature sma-miR1 16.10 Total number of reads matching the sma-mir1 precursor 140 Mature sma-miR1 read count 26 Percentage of reads corresponding to mature sma-miR1 18.57 mir1, S. maritima mir1, R. mangle

mir2, R. mangle mir2, S. maritima -miR2: AGGGACCAGGAGATTGGATC -miR2*: ACTCACTTCTTGGTCTTCGAC S. maritima Total number of reads matching the sma-mir2 precursor 164 Mature sma-miR2 read count 26 Percentage of reads corresponding to mature sma-miR2 15.85 mir2, R. mangle R. mangle Total number of reads matching the sma-mir2 precursor 65 Mature sma-miR2 read count 26 Percentage of reads corresponding to mature sma-miR2 40.00 mir2, S. maritima

mir3, R. mangle mir3, S. maritima -miR3: CGGAATATGGTAAAGTAGCTC Total number of reads matching the sma-mir3 precursor 83 Mature sma-miR3 read count 30 Percentage of reads corresponding to mature sma-miR3 36.14 Total number of reads matching the sma-mir3 precursor 146 Mature sma-miR3 read count 30 Percentage of reads corresponding to mature sma-miR3 20.54 mir3, R. mangle mir3, S. maritima

mir4, R. mangle mir4, H. littoralis mir4, S. maritima -miR4: CGTGGATGTTCTTATTTGGAC mir4, R. mangle mir4, H. littoralis mir4, S. maritima R. mangle H. littoralis S. maritima Total number of reads matching the sma-mir4 precursor 4 Mature sma-miR4 read count Percentage of reads corresponding to mature sma-miR4 100.00 Total number of reads matching the sma-mir4 precursor 25 Mature sma-miR4 read count 2 Percentage of reads corresponding to mature sma-miR4 8.00 Total number of reads matching the sma-mir4 precursor 50 Mature sma-miR4 read count 4 Percentage of reads corresponding to mature sma-miR4 8.00

mir5, R. mangle miR5, S. maritima -miR5: CTTGGTATGGAAGTTATGCATG -miR5*: GTAATGCTCATAACTTCCCTCT R. mangle S. maritima Total number of reads matching the sma-mir5 precursor 375 Mature sma-miR5 read count 75 Percentage of reads corresponding to mature sma-miR5 20.00 Total number of reads matching the sma-mir5 precursor 393 Mature sma-miR5 read count 75 Percentage of reads corresponding to mature sma-miR5 19.08 mir5, R. mangle miR5, S. maritima

mir6, R. mangle mir6, S. maritima mir6, O. sativa -miR6: GCATGGCTGTCGTCAGCTCGTG mir6, R. mangle mir6, S. maritima mir6, O. sativa R. mangle S. maritima O. sativa Total number of reads matching the sma-mir6 precursor 266 Mature sma-miR6 read count 142 Percentage of reads corresponding to mature sma-miR6 53.38 Total number of reads matching the sma-mir6 precursor 940 Mature sma-miR6 read count 149 Percentage of reads corresponding to mature sma-miR6 15.85 Total number of reads matching the sma-mir6 precursor 1657 Mature sma-miR6 read count 101 Percentage of reads corresponding to mature sma-miR6 06.00

mir7, R. mangle mir7, S. maritima mir7, O. sativa -miR7: TTTTCTTGACCTTGTAAGACC mir7, R. mangle mir7, S. maritima mir7, O. sativa R. mangle S. maritima O. sativa Total number of reads matching the sma-mir7 precursor 22 Mature sma-miR7 read count Percentage of reads corresponding to mature sma-miR7 100.00 Total number of reads matching the sma-mir7 precursor 320 Mature sma-miR7 read count 50 Percentage of reads corresponding to mature sma-miR7 15.62 Total number of reads matching the sma-mir7 precursor 22 Mature sma-miR7 read count Percentage of reads corresponding to mature sma-miR7 100.00

mir8, R. mangle -miR8: AAAAACCCTAAACCCTAAACC R. mangle Total number of reads matching the sma-mir8 precursor 66 Mature sma-miR8 read count 50 Percentage of reads corresponding to mature sma-miR8 75.75 mir8, R. mangle

mir9, R. mangle -miR9: AATACAAGCGTCGTGCTGCT R. mangle Total number of reads matching the sma-mir9 precursor 723 Mature sma-miR9 read count 273 Percentage of reads corresponding to mature sma-miR9 37.75 mir9, R. mangle

mir10, R. mangle -miR10: CCCAAGATGAGTGCTCTCCT R. mangle Total number of reads matching the sma-mir10 precursor 290 Mature sma-miR10 read count Percentage of reads corresponding to mature sma-miR10 100.00 mir10, R. mangle

mir11, R. mangle -miR11: TTCGGATCATTGTGCAATGTC R. mangle Total number of reads matching the sma-mir11 precursor 13 Mature sma-miR11 read count 3 Percentage of reads corresponding to mature sma-miR11 23.07 mir11, R. mangle

mir12, H. littoralis mir12, R. mangle -miR12: TTGCAGGATTTTACTATTGGGT Total number of reads matching the sma-mir12 precursor 3 Mature sma-miR12 read count 1 Percentage of reads corresponding to mature sma-miR12 33.33 Total number of reads matching the sma-mir12 precursor 15 Mature sma-miR12 read count 1 Percentage of reads corresponding to mature sma-miR12 06.66 mir12, H. littoralis mir12, R. mangle

mir13, R. mangle -miR13: TTAGATTCACGCACAAACTT R. mangle Total number of reads matching the sma-mir13 precursor 133 Mature sma-miR13 read count Percentage of reads corresponding to mature sma-miR13 100.00 mir13, R. mangle

mir166a, R. mangle mir166a, S. maritima -miR166a: TCGGACCAGGCTTCATTCCCC -miR166a*: GGAATGTTGTCTGGCTCGAGG mir166a, R. mangle mir166a, S. maritima

mir171b, R. mangle mir171b, S. maritima -miR171b: TGATTGAGCCGTGCCAATATC mir171b, R. mangle mir171b, S. maritima

mir396b, R. mangle mir396b, S. maritima -miR396b: TTCCACAGCTTTCTTGAACTT mir396b, R. mangle mir396b, S. maritima

mir159a, R. mangle mir159a, S. maritima -miR159a: TTTGGATTGAAGGGAGCTCTA -miR159a*: AGAGCTCCTTGATGTCCAAA mir159a, R. mangle mir159a, S. maritima

mir157a, S. maritima -miR157a: TTGACAGAAGATAGAGAGCAC -miR157a*: GCTCTCTATGCTTCTGTCATC mir157a, S. maritima

-miR164a: TGGAGAAGCAGGGCACGTGCA mir164a, S. maritima

-miR169a: CAGCCAAGGATGACTTGCCGA mir169a, S. maritima