Finding the potential miRNA-binding sites of the selected SNPs

Slides:

Advertisements

Similar presentations

Supplemental Figure 1 A No. at risk T T T

Advertisements

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr.

Fig. 1 Screening for miRNAs that regulate primordial follicle assembly in mouse ovaries. (a) A flow chart of the screening strategy. miRNAs that expressed.

Fig. 4. miR-326, miR-330, and miR-3099 bound to the GFAP 3'-UTR and regulated GFAP expression. (A) Schematic diagram of potential binding sequence (seed.

Volume 342, Issue 1, Pages (January 2014)

MLANA/MART1 and SILV/PMEL17/GP100 Are Transcriptionally Regulated by MITF in Melanocytes and Melanoma Jinyan Du, Arlo J. Miller, Hans R. Widlund, Martin.

Bufalin Inhibits the Differentiation and Proliferation of Cancer Stem Cells Derived from Primary Osteosarcoma Cells through Mir-148a Cell Physiol Biochem.

Cell Physiol Biochem 2013;31: DOI: /

Effect of microRNA-135a on Cell Proliferation, Migration, Invasion, Apoptosis and Tumor Angiogenesis Through the IGF-1/PI3K/Akt Signaling Pathway in Non-Small.

The Long Non-Coding RNA XIST Interacted with MiR-124 to Modulate Bladder Cancer Growth, Invasion and Migration by Targeting Androgen Receptor (AR) Cell.

Fig. 1. Effects of MD-2 promoter SNPs on transcription activity

Upregulation of miR-142-3p Improves Drug Sensitivity of Acute Myelogenous Leukemia through Reducing P-Glycoprotein and Repressing Autophagy by Targeting.

Tsai-Der Chuang, Ph.D., Omid Khorram, M.D., Ph.D.

Volume 144, Issue 3, Pages e4 (March 2013)

Novel Functional Single Nucleotide Polymorphisms in the Latent Transforming Growth Factor-β Binding Protein-1L Promoter Tomomi Higashi, Satoru Kyo, Masaki.

MicroRNA-451 plays a role in murine embryo implantation through targeting Ankrd46, as implicated by a microarray-based analysis Zhengyu Li, M.D., Jia.

miR-133a positively regulated p53/p21 pathway.

Volume 143, Issue 3, Pages e15 (September 2012)

MicroRNA-31 Promotes Skin Wound Healing by Enhancing Keratinocyte Proliferation and Migration Dongqing Li, X.I. Li, Aoxue Wang, Florian Meisgen, Andor.

Sp1 Suppresses miR-3178 to Promote the Metastasis Invasion Cascade via Upregulation of TRIOBP Hui Wang, Kai Li, Yu Mei, Xuemei Huang, Zhenglin Li, Qingzhu.

Supplementary figure S1 by Shin et al.

MicroRNA-92a-3p regulates the expression of cartilage-specific genes by directly targeting histone deacetylase 2 in chondrogenesis and degradation G.

MicroRNA-92a-3p regulates the expression of cartilage-specific genes by directly targeting histone deacetylase 2 in chondrogenesis and degradation G.

MicroRNA-489 Plays an Anti-Metastatic Role in Human Hepatocellular Carcinoma by Targeting Matrix Metalloproteinase-7 Yixiong Lin, Jianjun Liu, Yuqi Huang,

By Michael Fraczek and Caden Boyer

Psoriasis Skin Inflammation-Induced microRNA-26b Targets NCEH1 in Underlying Subcutaneous Adipose Tissue Louisa Cheung, Rachel M. Fisher, Natalia Kuzmina,

How MicroRNAs Modify Protein Production

L. Raymond, S. Eck, E. Hays, I. Tomek, M. D. , S. Kantor, M. D. , M

Molecular Therapy - Nucleic Acids

ATM Gene Mutations Result in Both Recessive and Dominant Expression Phenotypes of Genes and MicroRNAs Denis A. Smirnov, Vivian G. Cheung The American.

Human microRNA-155 on Chromosome 21 Differentially Interacts with Its Polymorphic Target in the AGTR1 3′ Untranslated Region: A Mechanism for Functional.

Volume 130, Issue 7, Pages (June 2006)

Supplemental Figure S1. Expression of MYOCD, MYOCD ceRNA and miRNAs

SP1 was a downstream target of miR-150-3p

miR-335 targeted RANKL and reduced osteoclast induction in SBC-5.

MicroRNA-101 Exerts Tumor-Suppressive Functions in Non-small Cell Lung Cancer through Directly Targeting Enhancer of Zeste Homolog 2 Ji-guang Zhang,

Wenqian Hu, Bingbing Yuan, Harvey F. Lodish Developmental Cell

Volume 156, Issue 4, Pages e8 (March 2019)

Dandan Wang et al. BTS 2018;3: miR-24 Regulates OGT and ATG4A to Play Cardioprotective Effects Sequence alignment of miR-24 targeting sites on OGT.

Role of Sp1 in Transcription of Human ATP2A2 Gene in Keratinocytes

Integrative Functional Genomics Implicates EPB41 Dysregulation in Hepatocellular Carcinoma Risk Xinyu Yang, Dianke Yu, Yanli Ren, Jinyu Wei, Wenting.

One SNP at a Time: Moving beyond GWAS in Psoriasis

Fig. 5. GUCD1 was a direct target of miR-370 in HCC

MiR-135b Stimulates Osteosarcoma Recurrence and Lung Metastasis via Notch and Wnt/β-Catenin Signaling Hua Jin, Song Luo, Yun Wang, Chang Liu, Zhenghao.

Kun-Peng Zhu, Xiao-Long Ma, Chun-Lin Zhang Molecular Therapy

XIST regulated miR-29c by directly targetting in TMZ-resistant glioma cells XIST regulated miR-29c by directly targetting in TMZ-resistant glioma cells.

Supplemental Figure 4 A no agonist MALP2 PAM3CSK4 GFP WT F217S

Supplemental Figure 1 A GENE chr location (hg18) SNP sample ID TLR2

ATM Gene Mutations Result in Both Recessive and Dominant Expression Phenotypes of Genes and MicroRNAs Denis A. Smirnov, Vivian G. Cheung The American.

Diverse Herpesvirus MicroRNAs Target the Stress-Induced Immune Ligand MICB to Escape Recognition by Natural Killer Cells Daphna Nachmani, Noam Stern-Ginossar,

USP2a-dependent miRs deregulation modulates MYC expression.

Negative Regulation of Tumor Suppressor p53 by MicroRNA miR-504

Expression of luciferase reporter gene in various promoter sequences.

Genetic Polymorphisms in the Polycomb Group Gene EZH2 and the Risk of Lung Cancer Kyong-Ah Yoon, MD, Hye Jin Gil, MS, Jihye Han, MS, Jaehee Park, MS,

Molecular Therapy - Nucleic Acids

Volume 26, Issue 3, Pages (March 2018)

MiR-431-5p directly targets RAF1 and is negatively correlated to RAF1 expression (A) The predicted binding sites of miR-431-5p and RAF1 3′-UTR, and mutant.

The Expression of MicroRNA-598 Inhibits Ovarian Cancer Cell Proliferation and Metastasis by Targeting URI Feng Xing, Shuo Wang, Jianhong Zhou Molecular.

Volume 4, Issue 4, Pages (April 2015)

Aberrant regulation of HDAC2 and its association with malignant proliferation of human gastric cancer. Aberrant regulation of HDAC2 and its association.

Volume 24, Issue 10, Pages (October 2016)

Figure 4. MicroRNA (miR)-195 and miR-497 directly targets CD274

Epigenetic regulation of p16INK4a in human gastric cancer.

Competition between FLYWCH1/β-catenin and TCF4/β-catenin complexes for their interaction to Tcf-DNA-binding sites. Competition between FLYWCH1/β-catenin.

A and B, mRNA expression relative to ERα (in%) for ZNF423 (A) and BRCA1 (B) for LCLs of known genotypes for variant (V) and WT chromosome 16 ZNF423 SNPs.

Targeting DCLK1 by miRNA-137.

Fig. 4 Dcr-2 binds to the 3′UTR of Toll mRNA.

HOXA11-AS acts as a ceRNA for miR-1297.

Trastuzumab resistance siRNA screen identifies PPM1H.

A B C Name Sequence TIMP3 promoter

Presentation transcript:

Finding the potential miRNA-binding sites of the selected SNPs Screening SNPs according to criteria of MAF in≥0.05 in Chinese Han population Searching for SNPs located in 3’-UTR of IL17A, IL17F, IL17RA, IL23R in database SNP Association analysis Finding the potential miRNA-binding sites of the selected SNPs SNP selection SNP genotyping and analysis Positive functional miRNA-binding SNP with bigger △△G Cell culture and transfection Functional study qRT-PCR analysis Western Blot analysis Luciferase report gene assay SUPPLEMENTAL FIGURE 1: The flow chart of the study experiments. The experiments mainly consist of two parts: association analysis for studying the associations between functional miRNA-binding sites single nucleotide polymorphisms (SNPs) with gastric cancer risk; functional study for preliminary verifying the regulatory role of miRNA on its corresponding positive SNPs.