1/11/16 Aim: We can determine how DNA controls trait expression. LAUNCH: HOMEWORK: Castle learning DUE TODAY Regents question from the back of launch
LAUNCH
LAUNCH
Protein Synthesis
Recall replication _________________ __________________ _________________ __________________ GATCTAGCTTTACG TAGCTAGCAGCTACT _________________ ___________________ GTTTTACGCGTACG ATGCGTGTGACGTGC The sequence of nitrogen bases is a code, what do you think the sequence codes for??
Replication practice worksheet Directions: For the following DNA base sequences, write the complementary DNA base sequences which leads to the production of an exact copy of DNA for each new cell. This process is called ………………………………………. This process occurs in which organelle? ………………………………………… DNA template: AAT TCG GAT CCG TAA GCA TGA Complement DNA: ……………………………………………………………………………… DNA template: GGC AAA TTA CCC GTT ATA TAT DNA template: CCC GGG TAC TAC CTT TTT GCT
Think about it: The sequence of nitrogen bases is a code, what do you think the sequence codes for?? DNA (codes for) PROTEINS (which have a) Specific shape (and therefore a) Specific function
What is a gene? Genes are the instructions for making proteins The sequence of the nucleotides determines which protein is made Example: ATT CCG GTA ATA codes for a specific enzyme.
RECALL DNA (codes for) PROTEINS (which have a) Specific shape (and therefore a) Specific function
Proteins and Cell Functioning The work of a cell is carried out by many types of molecules, many of them proteins. Protein = long chains of AMINO ACIDS called polypeptide chains. Sequence of 20 different amino acids gives the protein a unique shape and function. Proteins can become: Hormones (insulin) Enzymes (Amylase) Antibodies & antigens Organelles (cell membrane with receptor molecules) Pigmentation (eye, hair, and skin color)
Role in cell or organism Some functions of proteins include… Protein type Role in cell or organism Antibodies Defense-destroy disease causing bacteria and viruses Motor proteins Movement Enzymes Catalyze chemical reactions Hormones Coordinate cell activity Receptor molecule Cell communication Structural proteins Support for cells and tissues
1/12/16 Aim: We can determine how DNA controls trait expression. LAUNCH: HOMEWORK: Castle learning DUE FRI. QUIZ FRI Regents question from the back of launch
LAUNCH
HW
How are proteins made?
THINK ABOUT IT Can you give an example of where in life codes are used? How do they work? A Christmas story (Be sure to drink your Ovalteen). (3 min). https://www.youtube.com/watch?v=zdA__2tKoIU
Think about it We are studying protein synthesis. What is the ultimate job that is being accomplished?
How are proteins made? Protein synthesis: process by which a cell synthesizes (makes) proteins from DNA. Process begins in the nucleus of the cell. Since the DNA molecule does not leave the nucleus, it must make RNA molecules to bring messages to the ribosomes. The synthesis of the proteins takes place outside the nucleus at the ribosomes.
What is RNA (ribonucleic acid)? RNA is a nucleic acid, just like DNA. There are several differences. Three differences from DNA: RNA is a single strand, not double like DNA. RNA = ribose sugar ; DNA = deoxyribose sugar The base URACIL (U) takes the place of THYMINE (T).
DNA vs. RNA Complete the chart Double stranded molecule Sugar: deoxyribose Bases: A= adenine T= thymine G= guanine C= cytosine RNA Single stranded molecule Sugar: ribose Bases: A= adenine U= uracil G= guanine C= cytosine
BRAIN POP: DNA https://www.brainpop.com/science/cellularlifeandgenetics/dna/zoom.weml RNA https://www.brainpop.com/health/geneticsgrowthanddevelopment/rna/
How do we follow the steps of protein synthesis from DNA code to the synthesis of a protein? DNA (codes for) PROTEINS (which have a) Specific shape (and therefore a) Specific function
Think about it: Do you think that the DNA sequence AATTGCGG will code for the same protein as TTAACGCG How can you find out?
DNA vs. RNA DNA bases A-T C-G RNA bases A-U C-G
TRANSCRIPTION How does RNA transcribe the code on the DNA strand??
Types of RNA There are different types of RNA present in the cell Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomal RNA (rRNA) *Predict the functions of the types of RNA?
TRANSCRIPTION
Messenger RNA (mRNA) The copying of a genetic message into a molecule of mRNA is called TRANSCRIPTION Reads the code on DNA in groups of 3 bases called CODONS while in the nucleus. mRNA carries the message out of the nucleus to the ribosomes in the cytoplasm.
THINK ABOUT IT: How does an assembly line in a factory work? Give a description of an example.
Messenger RNA (mRNA) The copying of a genetic message into a molecule of mRNA is called TRANSCRIPTION Reads the code on DNA in groups of 3 bases called CODONS while in the nucleus. mRNA carries the message out of the nucleus to the ribosomes in the cytoplasm.
Transcription
Transcription
Messenger Molecule made here
Transcription demonstration power point presentation.
*Can you identify a codon? For the following DNA base sequences, write the complimentary base sequence: DNA: TAT CGT AAC GGA TCG RNA: _____________________________ DNA: CCG ATA GGG TAA GCT *Can you identify a codon?
Transcription practice worksheet Directions: For the following DNA base sequences, write the complementary messenger RNA (mRNA) base sequences which is necessary for protein synthesis. This process is called ………………………………………. This process occurs in which organelle? ……………………………………… DNA template: AAT TCG GAT CCG TAA GCA TGA mRNA strand: …………………………………………………………………………….. DNA template: GGC AAA TTA CCC GTT ATA TAT DNA template: CCC GGG TAC TAC CTT TTT GCT mRNA strand: …………………………………………………………………………….
Youtube: Transcription DNA STURUCTURE AND REPLICATION: Crash course Biology #10 (Or Amoeba sisters: Structure and function of DNA) http://www.youtube.com/watch?v=_POdWsii7AI Why RNA is just as cool as DNA http://www.youtube.com/watch?v=0Elo-zX1k8M
How does mRNA translate the codons into protein molecules?? TRANSLATION How does mRNA translate the codons into protein molecules??
Think about it How many other words can you make using the following letters TEAM?
TRANSLATION
Transfer RNA (tRNA) Brings amino acids to the ribosome. Dependent on the codon sequence of mRNA.
The Genetic Code:
Use the Universal Genetic Code Chart to translate the codons into Amino Acids AUG UUA CCA GGU _________________________________ CGU CUG GUU AAA
The Genetic Code:
Translation practice worksheet Directions: Use the codons, on the following mRNA strands, which were transcribed, to assemble the correct order of amino acids, in order to make the correct protein molecule. Use your Universal Genetic Code Chart to find the correct amino acid for each codon This process is called ___________________ and occurs in the ………………………………. with the help of which organelle? ……………. mRNA strand AUG CAU GGU CGU CCC GUC AAU Protein Molecule ……………………………………………………………………………………… mRNA GCG AAA GGU CCC CGU CUU AAG Protein Molecule ……………………………………………………………………………………… mRNA GCU CCG UCC UUA GGG GAU UUA
Practice worksheet page 1 Replication & Transcription DNA REPLICATION AAT TCG GAT CCG TAA GCA TGA GGC AAA TTA CCC GTT ATA TAT
Worksheet continued TRANSCRIPTION AAT TCG GAT CCG TAA GCA TGA GGC AAA TTA CCC GTT ATA TAT
List 3 differences between DNA and RNA - What is the primary function of RNA?
Practice worksheet page 2 Using the Genetic code mRNA Codons C U A G Amino acids
The Genetic Code:
Youtube: Protein Synthesis Amoeba sisters: Protein synthesis and the lean mean ribosome machine.) http://www.youtube.com/watch?v=h5mJbP23Buo
Steps of Protein Synthesis ~ Review Begins in the nucleus 1. Transcription: DNA is used to make a strand of mRNA in the nucleus. 2. mRNA travels to the ribosomes in the cytoplasm. 3. Translation: The codons are “read” by the ribosomes rRNA. tRNA transfers the proper amino acid (based on the codon sequence) to the ribosome for protein assembly. A protein (could be hundreds or thousands of amino acids long) is made; a polypeptide chain.
The function of the protein depends on the sequence of amino acids. The sequence of amino acids depends on the gene. The specific gene depends on the sequence of bases (A, T, C, G) in the DNA.
Protein Synthesis Newly forming protein molecule Ribosome Amino Acid Amino Acid Amino Acid U U U A A A U C C A G G Newly forming protein molecule Transfer RNA (tRNA) Messenger RNA (mRNA) Ribosome
Translation
Another protein synthesis picture mRNA moves through the ribosome and the code is read just a credit is swiped and the number is read. Direction mRNA moves through the ribosome
1/13/16 Aim: I can predict how a mutation effects the production of a protein molecule. LAUNCH: HOMEWORK: Castle learning DUE FRI. QUIZ FRI Regents question from the back of launch
LAUNCH
THINK ABOUT IT What if you dialed the wrong area code for someone you wanted to call? Example: 517-222-2121 Instead of 516-222-2121
Class activity: How DNA controls the workings of the cell
EVALUATION WHAT DID YOU LEARN TODAY? IF THERE IS AN ERROR DURING REPLICATION, WHAT IS THE EFFECT? WRITE ONE QUESTION THAT YOU STILL HAVE ABOUT WHAT YOU LEARNED TODAY TO DISCUSS TOMORROW.
Replication practice worksheet Directions: For the following DNA base sequences, write the complementary DNA base sequences which leads to the production of an exact copy of DNA for each new cell. This process is called ………………………………………. This process occurs in which organelle? ………………………………………… DNA template: AAT TCG GAT CCG TAA GCA TGA Complement DNA: ……………………………………………………………………………… DNA template: GGC AAA TTA CCC GTT ATA TAT DNA template: CCC GGG TAC TAC CTT TTT GCT
Transcription practice worksheet Directions: For the following DNA base sequences, write the complementary messenger RNA (mRNA) base sequences which is necessary for protein synthesis. This process is called ………………………………………. This process occurs in which organelle? ……………………………………… DNA template: AAT TCG GAT CCG TAA GCA TGA mRNA strand: …………………………………………………………………………….. DNA template: GGC AAA TTA CCC GTT ATA TAT DNA template: CCC GGG TAC TAC CTT TTT GCT mRNA strand: …………………………………………………………………………….
Translation practice worksheet Directions: Use the codons, on the following mRNA strands, which were transcribed, to assemble the correct order of amino acids, in order to make the correct protein molecule. Use your Universal Genetic Code Chart to find the correct amino acid for each codon This process is called ___________________ and occurs in the ………………………………. with the help of which organelle? ……………. mRNA strand AUG CAU GGU CGU CCC GUC AAU Protein Molecule ……………………………………………………………………………………… mRNA GCG AAA GGU CCC CGU CUU AAG Protein Molecule ……………………………………………………………………………………… mRNA GCU CCG UCC UUA GGG GAU UUA
The Genetic Code:
Goldie’s Room: Translation
SCANTRON On Quiz Name: Subject: Genetics Date: 2/28/14 Test No. Quiz 1 Period: Period 2 Name Date
Goldie’s room: Protein Synthesis
You tube Amoeba sisters: Protein synthesis and the lean mean ribosome machine. http://www.youtube.com/watch?v=h5mJbP23Buo
THINK ABOUT IT: A piece of a DNA code is AAA. During replication is copied the AAT instead of AAA. How will the mRNA read this strand of AAT? What effect will this have on the protein that is produced??? (What amino acid will it receive) What if it copied the codon as AAG???
DNA workshop activity http://www.pbs.org/wgbh/aso/tryit/dna Go to DNA workshop activity.
THINK ABOUT IT How does an assembly line in a factory work? Give a description of an example. We have been studying protein synthesis. What is the ultimate job that is being accomplished? How many other words can you make using the following letters TEAM? Will the DNA sequence AATTGCG code for the same protein as TTAACGC?? How can you find out? A piece of a DNA code is AAA. During replication it is copied as AAT instead of AAA. What effect will this have on the protein that is produced??? The sequence of bases on a DNA strand is a code. What if the code on DNA was copied wrong? How does DNA control the traits that are expressed???
AIMS How does DNA control the traits that are expressed??? What is heredity?? How does DNA control traits? How does DNA control the protein being synthesized? How are proteins synthesized? How is the code on DNA translated to synthesize proteins?? How does mRNA translate the codons into protein molecules?? Follow the steps of protein synthesis from DNA code to the synthesis of a protein. How does DNA control the traits that are expressed??? How does the DNA code determine the shape and function of a protein molecule? How do we follow the steps of protein synthesis from DNA code to the synthesis of a protein?
Copy your Weekend homework assignment: Review book assignment practice questions pages 160-162 questions 1-14. Use reading on pages 146-158 to help you. Bring review book to school on Monday to leave in classroom during the week. QUIZ MON.
Transcribe DNA into mRNA DNA sequence: ATTCCGTTTAGGACCATACGACGCCCC _______________________________________ DNA sequence: TTAGGTTTCATACGATATCCGGGGAAAATA ATTGGACGATTACGTTACCATCCGTATAACGGG _________________________________________