Species and adaptation B3 – Life on Earth Species and adaptation 5 a day revision What is extinction and how can it occur? What resources do animals or plants compete for? Define species. Describe how cacti are adapted to their environment. Explain why, in a species, there is variation between individuals and why this is important. @aegilopoides

5 a day revision B3 – Life on Earth Chains of life 5 a day revision What is interdependence? Describe 3 possible consequences of removing cod from this food web. Energy is transferred from one organism to the next in a food chain. What is energy used for at each stage in the food chain? The figures show the energy transferred through each stage of the food chain. Calculate the percentage efficiency of energy transfer between the phytoplankton and the humpback whale. Show your working. Sarah thinks the percentage efficiency of energy transfer between the phytoplankton and sharks would be less than the answer calculated above. Explain why she is correct. How is percentage efficiency calculated? @aegilopoides

5 a day revision B3 – Life on Earth Nutrient cycles Give 4 ways that carbon can be returned to the air. How is carbon passed between animals in the carbon cycle? Explain what is meant by nitrogen fixation. What is the role of decomposers in the carbon cycle? Outline the roles played by various groups of bacteria in the nitrogen cycle. @aegilopoides

Environmental indicators B3 – Life on Earth Environmental indicators 5 a day revision Suggest why plants are not used as indicators of water pollution. Give 2 examples of living indicators, other than mayfly nymphs. Give 3 examples of non-living indicators. Suggest why living indicators can be useful to scientists. The table shows the average number of mayfly nymphs found in rivers flowing through 3 different areas over a period of 5 years. Scientists want to set up a nature reserve in one of these areas. Suggest which area you would recommend. Use the data to explain your choice and give reasons why you have not chosen the other 2 areas. @aegilopoides

5 a day revision B3 – Life on Earth Variation & selection What is a mutation? How does selective breeding differ to natural selection? Outline the stages in natural selection. Explain how changes in the gene pool lead to evolution. Explain the recent increase in the number of black squirrels using ideas about natural selection. @aegilopoides

Evolution, fossils & DNA B3 – Life on Earth Evolution, fossils & DNA 5 a day revision What is a common ancestor? Why are organisms classified? Explain how evidence from the fossil record and DNA provides evidence for evolution. Give one reason why Lamarck’s theory of evolution was rejected in favour of Darwin’s. Compare the short DNA sequences from four species of primate and suggest what the evolutionary relationships of the animals are. Explain your reasoning. What other evidence would increase your confidence in your conclusion? Human: CTGGGCGCGTGCGGTTGTCCTGGTCCTGCT Chimpanzee: CCGGGCGCGTGCGGTTCACCAGGTCCTGCA Neanderthal: CCGGGCGCGAGCGGTTGTCCTGGTCCTGCA Gorilla: CAGGGCGCGGGAGGTTTACCACATGCTTCA @aegilopoides

Biodiversity and sustainability B3 – Life on Earth Biodiversity and sustainability 5 a day revision How can we improve sustainability in product manufacture? Outline the stages in a life cycle assessment. Define: Biodiversity Sustainability Explain why it is preferable to reduce the amount of packaging, even if it is biodegradable. Explain what a monoculture is, why it has negative effects on biodiversity and why it is not sustainable. @aegilopoides