Human Chimp How does DNA evolve? Nucleotide substitutions 1 ATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACT 50 ||||||||||||||||| ||||||| ||||||||||||||||||||||| 1 atgccccaactaaataccgccgtatgacccaccataattacccccatact 50 . . . . . 51 CCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACC 100 ||| |||||||| ||| |||||||||||||||||||||| |||| |||| 51 cctgacactatttctcgtcacccaactaaaaatattaaattcaaattacc 100 101 ACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCC 150 | ||||| ||||||||||| ||||||||||||||||| || || |||||| 101 atctacccccctcaccaaaacccataaaaataaaaaactacaataaaccc 150 151 TGAGAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACA 200 ||||||||||||||||||||||||| |||||||||||| |||||||||| 151 tgagaaccaaaatgaacgaaaatctattcgcttcattcgctgcccccaca 200 201 ATCC 204 |||| 201 atcc 204

New mutations = 2N x u Probability of a new mutation fixing = 1/2N Rate of NEUTRAL Evolution = 2Nu x 1/2N = u

Measuring DNA Evolution Align sequences Determine length of sequences Count number of differences Divergence = (number of differences) / (length of sequence) Divergence Rate = (sequence divergence) / (age of common ancestor) Substitution Rate = (sequence divergence) / (2Xage of common ancestor) D. melanogaster vs. D. simulans 3 diffs. D= =0.043 70 amino acids Rate of divergence = 0.043 = 1.74 x 10-8 amino acid differences per year 2.5 million years Substitution rate = half of that on each lineage (5 million TOTAL years of divergence)

Fixed differences vs. Polymorphisms • • • • -t MRCA -tw 0 = present Origination Fixation Site Frequency

• approximately linear sequence divergence over time Molecular clocks: • approximately linear sequence divergence over time • different genes have different functional constraints • this causes different rates of evolution • different nucleotide positions evolve at different rates http://www.bio.miami.edu/dana/250/betaglobinclock.jpg

Molecular clocks and the neutral theory Substitution of new allele AA Aa aa 1 1+s 1+2s Requires elimination of old allele Lots of genetic deaths Rates of molecular evolution are too fast to be explained by positive selection Too much genetic load Substitution load Load = (Woptimal - Wbar) / Woptimal Kimura: The majority of substitutions at the molecular level are neutral in evolution Different proteins evolve at different rates due to different levels of functional constraint • Observation: molecular clocks are approximately linear • • • Fibrino peptides • • Percent sequence divergence • • • Hemo globin • • • • • • • • • • • • • Cytochrome c • Date of divergence (millions of years)

Mutation drift equilibrium

Living fossils slow rates of morphological change Coelocanth Only living crossopterygian Thought to be extinct; caught in a net off Africa Horseshoe crab No obvious morphological change for ~150 million years Birds evolved Dinosaurs rose and went extinct Mammals , land plants diversified Horseshoe crab stasis due to life in relatively stable near-shore environment? http://www.aqua.org/images/feb/horseshoebig.jpeg

Tempo and Mode Of Evolution: Horseshoe ‘crabs’ and hermit crabs: Similar rates of molecular evolution different rates of morphological evolution

What defines a neutral mutation? Answer: When s < 1/2Ne Observation: Rates of molecular evolution are surprisingly constant in different species Puzzle: Why don’t species with short generation time have faster evolution? What defines a neutral mutation? Answer: When s < 1/2Ne http://www.google.com/imgres?q=house+mouse&um=1&hl=en&client=firefox-a&rls=org.mozilla:en-US:official&biw=1714&bih=981&tbm=isch&tbnid=IZhhqDhr6xCSSM:&imgrefurl=http://www.trap-tech.com/&docid=WqQ5JXFw3yHM0M&w=200&h=168&ei=_0qMTrCFOcbx0gGO18zaBA&zoom=1&iact=rc&dur=251&page=1&tbnh=134&tbnw=160&start=0&ndsp=40&ved=1t:429,r:31,s:0&tx=112&ty=48 http://images.nationalgeographic.com/wpf/media-live/photos/000/004/cache/african-elephant_435_600x450.jpg Short generation time: Many mutations Few are neutral (Ne is large) Long generation time: Few mutations Many are neutral (Ne is small)

Protein polymorphism and the neutral theory Observation from allozyme data: About 1/4 of loci are polymorphic About 3000 loci in fruitflies Heterozygosity ~ 0.3 on average Is variation maintained by selection? AA Aa aa 1-s 1 1-t This requires lots of genetic deaths Homozygotes eliminated Genetic load Segregation load Load = (Woptimal - Wbar) / Woptimal For 3000 loci with 10% selection (s and t = 5% each) this load could be huge Too much genetic death to allow balancing selection No problem if alleles are neutral No genetic load with neutrality SS SF FF SF FF SS SF SF well bands Geno types SS SF FF SF SS SF FF SF Monomorphic enzyme Dimeric Kimura and Ohta: Protein polymorphism as a phase Of neutral evolution