MINX RNA nt 120 nt 74 nt 45 nt M M 250 nt 150 nt 239 nt MINX RNA

Slides:

Advertisements

Similar presentations

Central dogma DNA is made (transcribed) into RNA RNA is made (translated) into protein.

Advertisements

Supplementary Material (Carriero & Damha) ’-GGGCGAATTCGAGCTCACTCTCTTCCGCATCGCTGTCTGCGAGGTACCCTACCAGGTGAG 3’-CCCGCTTAATCTCGAGTGAGAGAAGGCGTAGCGACAGACGCTCCATGGGATGGTCCACTC.

Ann Intern Med. 1993;119(10): doi: / Figure Legend:

Midterm Review Feb

Temperature: Comparing degrees Celsius (C) and degrees Fahrenheit (F)

VWF73, a region from D1596 to R1668 of von Willebrand factor, provides a minimal substrate for ADAMTS-13 by Koichi Kokame, Masanori Matsumoto, Yoshihiro.

محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)

Small RNA Sample Preparation

pRNA induces structural changes in 6S‐1 RNA

Volume 127, Issue 2, Pages (August 2004)

Jonathan A. Schumacher, Stephen D. Jenson, Kojo S. J

IgH PCR of Zinc Formalin-Fixed, Paraffin-Embedded Non-Lymphomatous Gastric Samples Produces Artifactual “Clonal” Bands Not Observed in Paired Tissues.

Volume 41, Issue 5, Pages (March 2011)

by Guang Yang, Shu-Ching Huang, Jane Y. Wu, and Edward J. Benz

Involvement of SR Proteins in mRNA Surveillance

Mutations in the Liver Glycogen Phosphorylase Gene (PYGL) Underlying Glycogenosis Type VI (Hers Disease) Barbara Burwinkel, Henk D. Bakker, Eliezer Herschkovitz,

Marco Baralle, Tibor Pastor, Erica Bussani, Franco Pagani

Ahyeon Son, Jong-Eun Park, V. Narry Kim Cell Reports

Volume 1, Issue 5, Pages (April 1998)

Volume 11, Issue 24, Pages (December 2001)

Christof Westenfelder, Diana L. Biddle, Robert L. Baranowski

Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas J.

Classification of Introns: U2-Type or U12-Type

Volume 13, Issue 1, Pages (January 2004)

Volume 117, Issue 3, Pages (April 2004)

Alexandra Scott, Hanna M

Volume 94, Issue 6, Pages (September 1998)

Rosemary C Dietrich, Robert Incorvaia, Richard A Padgett

Volume 5, Issue 6, Pages (June 2000)

Girish C Shukla, Richard A Padgett Molecular Cell

Volume 25, Issue 3, Pages (February 2007)

Pseudoexon Activation as a Novel Mechanism for Disease Resulting in Atypical Growth- Hormone Insensitivity Louise A. Metherell, Scott A. Akker, Patricia.

A Shared Surface of TBP Directs RNA Polymerase II and III Transcription via Association with Different TFIIB Family Members Xuemei Zhao, Laura Schramm,

A Presenilin-1 Truncating Mutation Is Present in Two Cases with Autopsy-Confirmed Early-Onset Alzheimer Disease Carolyn Tysoe, Joanne Whittaker, John.

Volume 6, Issue 5, Pages (November 2000)

Yasunori Aizawa, Qing Xiang, Alan M. Lambowitz, Anna Marie Pyle

Marc Spingola, Manuel Ares Molecular Cell

Overexpression of hsa-miR-148a promotes cartilage production and inhibits cartilage degradation by osteoarthritic chondrocytes L.A. Vonk, A.H.M. Kragten,

Roland Tacke, Masaya Tohyama, Satoshi Ogawa, James L Manley Cell

Retroviral vector–mediated transfer and expression of human tissue plasminogen activator gene in human endothelial and vascular smooth muscle cells Daryoush.

M.Joan Curcio, Marlene Belfort Cell

Figure 6. The DNA lyase activity of hNTHL1 contributes to the processing of lesions in nucleosomes, even in the ... Figure 6. The DNA lyase activity of.

The mlenapts RNA Helicase Mutation in Drosophila Results in a Splicing Catastrophe of the para Na+ Channel Transcript in a Region of RNA Editing Robert.

Pierre-Henri L Gaillard, Eishi Noguchi, Paul Shanahan, Paul Russell

Functional Link between the Mammalian Exosome and mRNA Decapping

Volume 6, Issue 3, Pages (September 2000)

Polypyrimidine Tract Binding Protein Blocks the 5′ Splice Site-Dependent Assembly of U2AF and the Prespliceosomal E Complex Shalini Sharma, Arnold M.

Aimee S. Browne, M. D. , M. Sc. , Jie Yu, M. D. , M. Sc

Volume 30, Issue 6, Pages (June 2008)

Cloning of a novel gene in the human kidney homologous to rat munc13s: Its potential role in diabetic nephropathy Yong Song, Menachem Ailenberg, Mel.

Volume 26, Issue 6, Pages (June 2007)

Functional Recognition of the 5′ Splice Site by U4/U6

Srabani Mukherjee, Luis G. Brieba, Rui Sousa Cell

Human Pre-mRNA Cleavage Factor Im Is Related to Spliceosomal SR Proteins and Can Be Reconstituted In Vitro from Recombinant Subunits Ursula Rüegsegger,

Michael J Dye, Nick J Proudfoot Molecular Cell

Effects of mifepristone on expression of endothelial nitric oxide synthase in human endometrium during the implantation phase Xiaoxi Sun, M.D., Xiaoyan.

Fig. 4. Coilin phosphomutant displays differential RNA binding and degradation activities.Purified proteins were analyzed for RNase activity with total.

Expression and presence of the platelet-activating factor receptor in human embryos William E Roudebush, PhD, Joe B Massey, MD, Hilton I Kort, MD, Carlene.

Beyond Homing: Competition between Intron Endonucleases Confers a Selective Advantage on Flanking Genetic Markers Heidi Goodrich-Blair, David A Shub

An Early Developmental Transcription Factor Complex that Is More Stable on Nucleosome Core Particles Than on Free DNA Lisa Ann Cirillo, Kenneth S Zaret

Volume 58, Issue 6, Pages (December 2000)

Xingyu Wang, Can Li, Xiaomeng Gao, Jing Wang, Xingguo Liang

Ali Hamiche, Raphael Sandaltzopoulos, David A Gdula, Carl Wu Cell

A Minimal RNA Polymerase III Transcription System from Human Cells Reveals Positive and Negative Regulatory Roles for CK2 Ping Hu, Si Wu, Nouria Hernandez

Functional Coupling of Capping and Transcription of mRNA

Agarose gel electrophoresis of ribosomal RNA gene polymerase chain reaction (PCR) products using Borrelia afzelii (top) and B burgdorferi sensu stricto.

Nonsense-Associated Altered Splicing

Exon Skipping in IVD RNA Processing in Isovaleric Acidemia Caused by Point Mutations in the Coding Region of the IVD Gene Jerry Vockley, Peter K. Rogan,

Volume 113, Issue 2, Pages (July 2017)

Human Argonaute2 Mediates RNA Cleavage Targeted by miRNAs and siRNAs

Presentation transcript:

MINX RNA - 239 nt 120 nt 74 nt 45 nt M M 1 2 3 4 5 6 7 8 8 7 6 5 4 3 2 1 250 nt 150 nt 239 nt MINX RNA 200 nt 100 nt 150 nt 50 nt Background dot 100 nt 50 nt 6% PAGE 8M urea 13% PAGE 8M urea Lanes M- 50 bp DNA ladder NEB, 1-MINX RNA control (untreated), 2-MINX+Cyto fraction (negative control), 3-HeLa NE Batch I, 4- Hela Ne Batch 2, 6 & 8 - HeLa NE Batch 1 & 2 respectively (duplicate reaction another day). Has splicing worked here? If yes, what are the bands of interest? I don’t see bands corresponding to lauriate intron and intermediate which form bands above substrate as seen in many articles. Pls help Reaction was at 30degree Celsius for 3 hours with 80 ug protein (Ne-50% reaction volume)