Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus.

Slides:

Advertisements

Similar presentations

Table 1. Degenerate potyvirus primers used to detect potyviruses in Iraqi plants by RT-PCR. NT: not tested, NS: non specific bands, +: positive, -: negative,

Advertisements

Insert A tree starts with the dummy node D D 200 D 7 Insert D

ResistVir Mechanisms and sources of resistance Josef SPAK Academy of Sciences of the Czech Republic, Ceske Budejovice

PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1 PfDGAT1-2 AtDGAT1 RcDGAT1 PfDGAT1-1.

Agricultural Research Institute of the Hungarian Academy of Sciences Detecting inter- and intraspecific recombination events in plant RNA viruses with.

Stem and Leaf Bingo. Pick 8 from the list

Supplementary Fig. S1. 16S RNA Neighbor-joining (NJ) tree of Brevibacterium metallicus sp. nov. NM2E3 T (in bold) and related species of genus Brevibacterium.

Point Mutations Silent Missense Nonsense Frameshift.

Chapter 17 How to read a table of codons. These are two forms in which you might see a table of codons.

Copyright OpenHelix. No use or reproduction without express written consent1.

Question 4 Tutorial 8. Part A Insert 20, 10, 15, 5,7, 30, 25, 18, 37, 12 and 40 in sequence into an empty binary tree

Primers to map bsd deletion points on genomic DNA NameForwardReverse Amplicon size (base pairs) A15’-CCACGGATGGAGTGAGTTCT-3’5’-GCCCCCAAGATGAGGATTAT-3’931.

DNA Questions What makes up a DNA backbone? How would you describe how DNA looks? Name the 4 bases that make up DNA. “T” base can only match with? What.

BrGGP2 Gene information BrGGP Gene information

Table S4. Properties of H5N1 influenza viruses in sublineage BI.

Variation among organisms

Supplemental Digital Content 1. Table: Primers

S1 File. Numbers of reads mapped on reference viral sequences – SOAP.

Reads aligned into contigs

Supplementary Figure 1 ORF2 ORF3 Nelorpivirus (Group I Negevirus)

Sequence and structure relatedness of matrix protein of human respiratory syncytial virus with matrix proteins of other negative-sense RNA viruses K.

by Mark T. Boyd, Brian Foley, and Isadore Brodsky

Viral diseases of potato

by Nancy D. Borson, Martha Q. Lacy, and Peter J. Wettstein

From Mosquitos to Humans: Genetic Evolution of Zika Virus

The triplet code Starter A DNA molecule is 23% guanine.

Bioinformatics and BLAST

F - Ratio Table Degrees of Freedom for the Factor

Figure 17. 1: An Example of a One-Factor Spot Rate Process Figure 17.1: An Example of a One-Factor Spot Rate Process. Actual Probabilities.

Accurate genotyping of hepatitis C virus through nucleotide sequencing and identification of new HCV subtypes in China population Y.-Q. Tong, B. Liu,

Prediction of virological response by pretreatment hepatitis B virus reverse transcriptase quasispecies heterogeneity: the advantage of using next-generation.

J. -C. Lagier, F. Armougom, M. Million, P. Hugon, I. Pagnier, C

E. Descloux, C. La Fuentez, Y. Roca, X. De Lamballerie

Pre AP Biology Viruses 8.2.

Pre AP Biology Viruses 8.2.

Bioinformatics for plant biosecurity and surveillance systems

Prediction of protein structure

Detection and identification of plasma bacterial and viral elements in HIV/AIDS patients in comparison to healthy adults S.-K. Li, R. K-K. Leung, H.-X.

چرا نهال عاری از ویروس؟ حمید عبداللهی محقق موسسه تحقیقات علوم باغبانی.

Mukoye B., Mangeni B. C., Ndong’a M. F. O. and Were H. K.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

Accurate genotyping of hepatitis C virus through nucleotide sequencing and identification of new HCV subtypes in China population Y.-Q. Tong, B. Liu,

Apple mosaic ilarvirus

L. Dubourg Clinical Microbiology and Infection

Practice Clone 3 Download and get ready!.

A. Papa, K. Dumaidi, F. Franzidou, A. Antoniadis

Volume 7, Issue 1, Pages (January 2014)

Pre AP Biology Viruses 8.2.

Table 1. Occurrence of N-X-S/T motives in tryptic peptides1

A, high resolution MS/MS spectrum (lower panel) of 1435

Schematic diagrams of genomic structure, the strategy for genomic cDNA cloning, and molecular characterization of unique features of three emergent U.S.

Structural evidence: Embryonic similarities Vestigial organs

Sequence and structure relatedness of matrix protein of human respiratory syncytial virus with matrix proteins of other negative-sense RNA viruses K.

(n = 12) (n = 6) No. of sentinel lymph nodes, n (%)

Volume 133, Issue 3, Pages (September 2007)

Volume 66, Issue 1, Pages (January 2017)

The Arabidopsis NPR1 Gene That Controls Systemic Acquired Resistance Encodes a Novel Protein Containing Ankyrin Repeats Hui Cao, Jane Glazebrook, Joseph.

Mathieu Nonnenmacher, Harm van Bakel, Roger J Hajjar, Thomas Weber

TAKS Objective 2 The student will demonstrate an understanding of the organization of living systems.

Identification of the GCS1 ortholog in Gonium pectorale.

BETONLINEBETONLINE A·+A·+

Superspacers shared between viral strains.

Phylogenetic tree of medically important flaviviruses based on E protein amino acid diversity. Phylogenetic tree of medically important flaviviruses based.

Sequence variation of 16S rRNA gene primer-binding sites.

Characterization of SsPV1/WF-1 isolated from hypovirulent strain WF-1.

An Extended Signal Involved in Eukaryotic −1 Frameshifting Operates through Modification of the E Site tRNA Michaël Bekaert, Jean-Pierre Rousset Molecular.

(A) Bayesian phylogenetic tree of the H gene nucleotide alignment from tigers Pt2004 and Pt and representative CDV sequences obtained from GenBank.

by Honglin Chen, Paul Smith, Richard F. Ambinder, and S. Diane Hayward

Phylogenetic trees for fusion (F) and attachment (G) genes of selected HMPV isolates. Phylogenetic trees for fusion (F) and attachment (G) genes of selected.

Detection of positive and negative KRBV genomic RNA strands as an indication of viral replication. Detection of positive and negative KRBV genomic RNA.

Presentation transcript:

Supplementary Table 1. Primers used for sequence analysis and detection of a novel ilarvirus (apple necrotic mosaic virus, ApNMV) and Apple mosaic virus (ApMV) Use Primer Sequence　(5´-3´) Sequence analysis R1-node268+ atgcttccgagattcaggag R1-node31- cttcgaagtagttagcgtcc R1-node31+ agacacacgaagaggttcac R2-node305+ ggaagacggatgtgtcgaaa R3-node76+ ttccatcttgcgtgcaatcg 5’RACE-R1-S1 agttgaacgctcattaccga 5’RACE-R1-S2 ggaaggtgagagactaaatg 5’RACE-R1-A1 acgtctcgtctgcacattgt 5’RACE-R1-A2 gtggatactagcaactcgga 5’RACE-R1-RT acagagccttctgct 5’RACE-R2-S1 cgtggattgtggacagatgg 5’RACE-R2-S2 ggtgtttgacattccgacac 5’RACE-R2-A1 ctcgaacttcggtctgaaga 5’RACE-R2-A2 tctcacatctcccatacgac 5’RACE-R2-RT tgactgactgttgag 5’RACE-R3-S1 gtcgaaacagatgacttacg 5’RACE-R3-S2 ccgaatcccatcatgtttcc 5’RACE-R3-A1 acacatgtctccaactcgag 5’RACE-R3-A2 caccaactttgctttcgacg 5’RACE-R3-RT tgtgctggacacgtt Detection of ApNMV and ApMV ApNMV-CP+1 cttgcgtgcaatcgatatgg ApNMV-CP-1 tcatctcaacctagacatcc ApMV-CP+1 caacatggtctgcaagtact ApMV-CP-1 ggagctaatcgctccatcat ApNMV-CP+2 atggtgtgcaatcgctgtca ApNMV-CP-2 catcgaccataaggatatca ApMV-CP+2 tggatcttgcgctggatgca ApMV-CP-2 acattcgtcggtatttgcac

Supplementary Table 2. Number of contigs from next generation sequencing of an apple tree (P129) matched to viral sequences by blastx analysis No. of contigs Matched virus (genus) Identity (%) 280 Apple stem pitting virus (Foveavirus) 100~61.33 18 Apricot latent virus-like (Foveavirus) 98.36~88.37 65 Apple stem grooving virus (Capillovirus) 100~74.89 5 Apple chlorotic leaf spot virus (Trichovirus) 100~93.15 11 Prunus necrotic ringspot virus (Ilarvirus) 76.19~65.28 1 Apple mosaic virus (Ilarvirus) 57.34 105 Other Total 485

Supplementary Table 3. Percentage of nucleotide and amino acid sequence identities of CPs among viruses (P129, PK45, PK28, and P133) from apple trees showing mosaic symptoms and ApMV Tree P129 PK45 PK28 P133 ApMV P129 (219 aa) 94 56 PK45 (219 aa) 95 PK28 (219 aa) 92 55 P133 (223 aa) 43 44 88 ApMV (219 aa) 91 The upper right corner represents nucleotide sequence identities, and the lower left corner is amino acid sequence identities. The sequence of apple mosaic virus (ApMV) was from GenBank/EMBL/.DDBJ database accession no. U15608.