FLiPS Functional Linkage Prediction Service.

Slides:



Advertisements
Similar presentations
Protein Targeting by Functional Linkage of Non-Homologous Proteins with examples from M. tuberculosis Genome-wide functional linkage map Structural Genomics.
Advertisements

Gene Regulation and Expression
Section 12 – 5 Gene Regulation
Chapter 18 Regulation of Gene Expression.
To understand the concept of the gene function control. To understand the concept of the gene function control. To describe the operon model of prokaryotic.
Four of the many different types of human cells: They all share the same genome. What makes them different?
Research Methodology of Biotechnology: Protein-Protein Interactions Yao-Te Huang Aug 16, 2011.
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Protein-protein interactions
Protein domains vs. structure domains - an example.
Protein interaction Computational (inferred) Experimental (observed)
Regulation of Gene Expression
Functional Linkages between Proteins. Introduction Piles of Information Flakes of Knowledge AGCATCCGACTAGCATCAGCTAGCAGCAGA CTCACGATGTGACTGCATGCGTCATTATCTA.
Functional Associations of Protein in Entire Genomes Sequences Bioinformatics Center of Shanghai Institutes for Biological Sciences Bingding.
Gene Expression Cells use information in genes to build hundreds of different proteins, each with a specific function. But, not all proteins are required.
Gene Regulatory Network Inference. Progress in Disease Treatment  Personalized medicine is becoming more prevalent for several kinds of cancer treatment.
CONTROL MECHANISMS 5.5. Controlling Transcription and Translation of Genes  Housekeeping Genes: needed at all times: needed for life functions vital.
Improving Gene Function Prediction Using Gene Neighborhoods Kwangmin Choi Bioinformatics Program School of Informatics Indiana University, Bloomington,
CISC841, F08, Lec2, Liao CISC 841 Bioinformatics (Fall 2008) A Primer on Molecular Biology & Bioinformatics challenges.
Trp Operon A brief description. Introduction a repressible system In this system, though, unlike the lac operon, the gene for the repressor is not adjacent.
Anis Karimpour-Fard ‡, Ryan T. Gill †,
The Operon 操縱元 a functioning unit of genomic material containing a cluster of genes under the control of a single regulatory signal or promoter.
How Does A Cell Know? Which Gene To Express Which Gene To Express& Which Gene Should Stay Silent? Which Gene Should Stay Silent?
Control of Gene Expression Chapter Proteins interacting w/ DNA turn Prokaryotic genes on or off in response to environmental changes  Gene Regulation:
PPI team Progress Report PPI team, IDB Lab. Sangwon Yoo, Hoyoung Jeong, Taewhi Lee Mar 2006.
I. Prolinks: a database of protein functional linkage derived from coevolution II. STRING: known and predicted protein-protein associations, integrated.
Introduction to biological molecular networks
© 2011 Pearson Education, Inc. Lectures by Stephanie Scher Pandolfi BIOLOGICAL SCIENCE FOURTH EDITION SCOTT FREEMAN 17 Control of Gene Expression in Bacteria.
1 Computational functional genomics Lital Haham Sivan Pearl.
DNA-Protein Interactions & Complexes. Prokaryotic promoter Consensus sequence is not present in majority of prokaryotic promoters. Sequence motifs.
Detecting Protein Function and Protein-Protein Interactions from Genome Sequences TuyetLinh Nguyen.
Control of Metabolic Pathways Higher Human Biology Unit 1 – Section 6 Metabolic Pathways.
The control of gene expression enable individual bacteria to adjust their meta- bolism to environmental change.
Protein Synthesis. Central Dogma Transcription - mRNA Genetic information is first transcribed into an RNA molecule. This intermediary RNA molecule is.
Chapter 18.1 Contributors of Genetic Diversity in Bacteria.
Transcription(I) 王之仰.
Networks and Interactions
The Operon.
(Regulation of gene expression)
Gene Regulation and Expression
Controlling the genes Lecture 15 pp
Protein Families, Motifs & Domains.
Interactions between complementary SNAREs may determine the specificity of vesicle targeting to an acceptor membrane. SNAREs are integral membrane proteins.
Gene Regulation.
Large Scale Data Integration
Regulation of Gene Expression
Regulation of Gene Expression
Protein Interaction Networks
Regulation of Gene Expression
Cellular Metabolism Metabolic processes – all chemical reactions that occur in the body Cellular metabolism- refers to all of the chemical processes that.
Regulation of Gene Expression
Regulation of Gene Expression
Jue Chen, Gang Lu, Jeffrey Lin, Amy L Davidson, Florante A Quiocho 
How Proteins are Made Biology I: Chapter 10.
Gene Expression AP Biology.
Protein Basics Protein function Protein structure
Gene Regulation certain genes are transcribed all the time – constitutive genes synthesis of some proteins is regulated and are produced only when needed.
Summary of chemical reactions in a cell
Regulation of Gene Expression
The control of gene expression enable individual
Bioinformatics, Vol.17 Suppl.1 (ISMB 2001) Weekly Lab. Seminar
Figure 8.1 Partial genetic map of E. Coli.
Schematic representation of Mal transport and regulon.
Gautam Dey, Tobias Meyer  Cell Systems 
Yamanishi, M., Itoh, M., Kanehisa, M.
Chapter 18 Bacterial Regulation of Gene Expression
Review Warm-Up What is the Central Dogma?
CISC 667 Intro to Bioinformatics (Spring 2007) Genetic networks and gene expression data CISC667, S07, Lec24, Liao.
Concerted model for maltose transport.
Schematic view of the organization of transport systems.
Presentation transcript:

FLiPS Functional Linkage Prediction Service

Functional Linkage of Proteins Protein-Protein Interaction Protein Complex Metabolic and Signaling Pathway

Prediction of Functional Linkage Genome Context Analysis (GCA) Phylogenetic Profile (PP) method Rosetta Stone (RS) method Gene Neighbor (GN) method Gene Cluster (GC) method

Phylogenetic Profile Method The Phylogenetic Profile Method uses the co-occurrence or absence of pairs of nonhomologous genes across genomes to infer functional relatedness. Phylogenetic profile

Phylogenetic Profile Method Next, we determine the probability that two proteins have coevolved; this is based on the similarity of their profiles.

Rosetta Stone Method Occasionally, two proteins expressed separately in one organism can be bound as a single chain in the same or a second genome. Analysis of gene fusion/division events to infer functional relatedness Rosetta Stone protein

Rosetta Stone Method To screen out these confounding fusion events we compute the probability that two proteins are found linked by the Rosetta Stone method by chance alone

Gene Neighbor Method Some of the operons contained within a particular organism may be conserved across other organisms. The genes within the operon are functionally coupled and are perhaps components of a protein complex or pathway.

Gene Neighbor Method We generate a P value for the likelihood that two proteins are coded within a conserved operon.

Gene Cluster Method Within bacteria, proteins of closely related function are often transcribed from a single functional unit known as an operon

Gene Cluster Method We assume that the probability that two genes that are adjacent and coded on the same strand are part of an operon is 1-P.

Functional Linkage Prediction System

Ex) Protein-Protein Interaction Figure 5 Genome Res. 2006 May;16(5):686-91 Large-scale comprehensive pull-down assay Result of FLiPS

Ex) Protein Complex Result of FLiPS Proc Natl Acad Sci U S A. 1992 March 15; 89(6): 2360–2364 Result of FLiPS Maltose transport across the cytoplasmic membrane of Escherichia coli is dependent on the presence of a periplasmic maltose-binding protein (MBP), the product of the malE gene. The products of the malF, malG, and malK genes form a membrane-associated complex that catalyzes the hydrolysis of ATP to provide energy for the transport event.

Ex) Pathway b2020 b2022 b2021 b2023 b2024 b2019 b2026 Result of FLiPS

Ex) Annotation of Hypothetical Protein

Ex) Annotation of Hypothetical Protein