Dr. Kenneth Stanley September 25, 2006

Slides:



Advertisements
Similar presentations
Evolution and Populations
Advertisements

On the Genetic Evolution of a Perfect Tic-Tac-Toe Strategy
Linkage Learning in Evolutionary Algorithms. Recombination Missouri University of Science and Technology Recombination explores the search space Classic.
Neuro-Evolution of Augmenting Topologies Ben Trewhella.
Genetic Algorithms. Some Examples of Biologically Inspired AI Neural networks Evolutionary computation (e.g., genetic algorithms) Immune-system-inspired.
Evolving Neural Network Agents in the NERO Video Game Author : Kenneth O. Stanley, Bobby D. Bryant, and Risto Miikkulainen Presented by Yi Cheng Lin.
1. 2 overview Background on video games Background on video games Neural networks Neural networks NE NE NEAT NEAT rtNEAT rtNEAT NERO NERO.
Intro to AI Genetic Algorithm Ruth Bergman Fall 2004.
Attack-Resistant Networks Allen G. Taylor Communication networks have four primary objectives: Minimize.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Multiple Sequence Alignment CSC391/691 Bioinformatics Spring 2004 Fetrow/Burg/Miller (Slides by J. Burg)
Evolving Multi-modal Behavior in NPCs Jacob Schrum – Risto Miikkulainen –
Genetic Algorithm.
Evolutionary Robotics NEAT / HyperNEAT Stanley, K.O., Miikkulainen (2001) Evolving Neural Networks through Augmenting Topologies. Competing Conventions:
1 Evolutionary Growth of Genomes for the Development and Replication of Multi-Cellular Organisms with Indirect Encodings Stefano Nichele and Gunnar Tufte.
Evolution by Natural Selection
SOFT COMPUTING (Optimization Techniques using GA) Dr. N.Uma Maheswari Professor/CSE PSNA CET.
Evolutionary Computation. Evolutionary Complexification Two major goals in intelligent systems are the discovery and improvement of solutions to complex.
CAP6938 Neuroevolution and Developmental Encoding Working with NEAT Dr. Kenneth Stanley September 27, 2006.
CS 484 – Artificial Intelligence1 Announcements Lab 3 due Tuesday, November 6 Homework 6 due Tuesday, November 6 Lab 4 due Thursday, November 8 Current.
Genetic Algorithms Michael J. Watts
CAP6938 Neuroevolution and Developmental Encoding Developmental Encoding 2 Dr. Kenneth Stanley October 9, 2006.
CAP6938 Neuroevolution and Developmental Encoding Real-time NEAT Dr. Kenneth Stanley October 18, 2006.
Learning by Simulating Evolution Artificial Intelligence CSMC February 21, 2002.
CAP6938 Neuroevolution and Developmental Encoding Basic Concepts Dr. Kenneth Stanley August 23, 2006.
Mike Taks Bram van de Klundert. About Published 2005 Cited 286 times Kenneth O. Stanley Associate Professor at University of Central Florida Risto Miikkulainen.
1 Genetic Algorithms K.Ganesh Introduction GAs and Simulated Annealing The Biology of Genetics The Logic of Genetic Programmes Demo Summary.
Introduction to History of Life. Biological evolution consists of change in the hereditary characteristics of groups of organisms over the course of generations.
Introduction to Genetic Algorithms. Genetic Algorithms We’ve covered enough material that we can write programs that use genetic algorithms! –More advanced.
CAP6938 Neuroevolution and Artificial Embryogeny Evolving Adaptive Neural Networks Dr. Kenneth Stanley March 1, 2006.
CAP6938 Neuroevolution and Developmental Encoding Intro to Neuroevolution Dr. Kenneth Stanley September 18, 2006.
1 Autonomic Computer Systems Evolutionary Computation Pascal Paysan.
CAP6938 Neuroevolution and Artificial Embryogeny Approaches to Neuroevolution Dr. Kenneth Stanley February 1, 2006.
CAP6938 Neuroevolution and Artificial Embryogeny Evolutionary Computation Theory Dr. Kenneth Stanley January 25, 2006.
CAP6938 Neuroevolution and Artificial Embryogeny Evolutionary Comptation Dr. Kenneth Stanley January 23, 2006.
CAP6938 Neuroevolution and Artificial Embryogeny Real-time NEAT Dr. Kenneth Stanley February 22, 2006.
Genetic Algorithms. Solution Search in Problem Space.
CAP6938 Neuroevolution and Artificial Embryogeny Real-time NEAT Dr. Kenneth Stanley February 22, 2006.
Haploid-Diploid Evolutionary Algorithms
Genetic Algorithms.
Dr. Kenneth Stanley September 11, 2006
Evolutionary Algorithms Jim Whitehead
Reconstructing the Evolutionary History of Complex Human Gene Clusters
Dr. Kenneth Stanley January 30, 2006
HyperNetworks Engın denız usta
Dr. Kenneth Stanley September 13, 2006
Example: Applying EC to the TSP Problem
Evolution as Genetic Change
Multy- Objective Differential Evolution (MODE)
Haploid-Diploid Evolutionary Algorithms
Introduction to CAP6938 Neuroevolution and Developmental Encoding
Basics of Genetic Algorithms (MidTerm – only in RED material)
Example: Applying EC to the TSP Problem
Evolution of Populations
Dr. Kenneth Stanley September 20, 2006
Evolution as Genetic Change
Example: Applying EC to the TSP Problem
Homework #4 is due 12/4/07 (only if needed)
GENETIC ALGORITHMS & MACHINE LEARNING
Speciation.
Introduction to Artificial Intelligence Lecture 11: Machine Evolution
There is a Great Diversity of Organisms
Dr. Kenneth Stanley February 6, 2006
Basics of Genetic Algorithms
Boltzmann Machine (BM) (§6.4)
Natural Selection Natural selection: organisms with favorable traits for a particular environment survive, reproduce, and pass these traits on to the next.
History of Biological Diversity Evolution: Darwin’s travel
Machine Learning: UNIT-4 CHAPTER-2
Genetic Variation MT: Allele Frequency.
Coevolutionary Automated Software Correction
Presentation transcript:

Dr. Kenneth Stanley September 25, 2006 CAP6938 Neuroevolution and Developmental Encoding NeuroEvolution of Augmenting Topologies (NEAT) Dr. Kenneth Stanley September 25, 2006

TWEANN Problems Reminder Competing conventions problem Topology matching problem Initial population topology randomization Defective starter genomes Unnecessarily high-dimensional search space Loss of innovative structures More complex can’t compete in the short run Need to protect innovation NEAT directly addresses these challenges

Solutions: NEAT Historical markings match up different structures Speciation Keeps incompatible networks apart Protects innovation Incremental growth from minimal structure, i.e. complexification Avoids searching in unnecessarily high-d space Makes finding high-d solutions possible

Genetic Encoding in NEAT

Topological Innovation

Link Weight Mutation A random number is added or subtracted from the current weight/parameter The number can be chosen from uniform, Gaussian (normal) or other distributions Continuous parameters work best if capped The probability of mutating a particular gene may be low or high, and is separate from the magnitude added Probabilities and mutation magnitudes have a significant effect

Link Weight Mutation in NEAT C++ randnum=randposneg()*randfloat()*power; if (mut_type==GAUSSIAN) { randchoice=randfloat(); if (randchoice>gausspoint) ((*curgene)->lnk)->weight+=randnum; else if (randchoice>coldgausspoint) ((*curgene)->lnk)->weight=randnum; } else if (mut_type==COLDGAUSSIAN) //Cap the weights at 3.0 if (((*curgene)->lnk)->weight > 3.0) ((*curgene)->lnk)->weight = 3.0; else if (((*curgene)->lnk)->weight < -3.0) ((*curgene)->lnk)->weight = -3.0;

Topology Matching Problem Problem arises from adding new genes Same gene may be in different positions Different genes may be in same positions

Biological Motivation New genes appeared over biological evolution as well Nature has a solution to still know which is which Process of aligning and matching genes is called synapsis Uses homology to align genes: “. . .Crossing over thus generates homologous recombination; that is, it occurs between 2 regions of DNA containing identical or nearly identical sequences.” (Watson et al. 1987)

Artificial Synapsys: Tracking Genes through Historical Markings The numbers tell exactly when in history particular topological features appeared, so now they can be matched up any time in the future. In other words, they reveal gene homology.

Matching up Genes

Second Component: Speciation Protects Innovation Originally used for multimodal function optimization (Mahfood 1995) Organisms grouped by similarity (compatibility) Fitness sharing (Goldberg 1987, Spears 1995): Organisms in a species share the reward of their fitness peak To facilitate this, NEAT needs A compatibility measure Clustering based on compatibility, for fitness sharing

Measuring Compatibility Possible in NEAT through historical markings 3 factors affect compatibility via historical markings on connection genes: Excess Disjoint Average Weight Distance W Compatibility distance

Clustering Into Species

Dynamic Compatibility Thresholding

Fitness Sharing: Assigning Offspring to Species

Third Component: Complexification from Minimal Structure Addresses initialization problem Search begins in minimal-topology space Lower-dimensional structures easily optimized Useful innovations eventually survive So search transitions into good part of higher-dim. space The ticket to high-dimensional space

NEAT Performed Well on Double Pole Balancing Without Velocity Inputs

DPNV Solutions Are Compact

Harder DPNV (0.3m short pole) solution

Visualizing Speciation

Next Class: More NEAT Implementation issues Where NEAT can be changed Areas for advancement Issues in applying NEAT (e.g. sensors and outputs) Evolving a Roving Eye for Go by Kenneth O. Stanley and Risto Miikkulainen (2004) Neuroevolution of an Automobile Crash Warning System by Kenneth O. Stanley and Risto Miikkulainen (2005)