ELIXIR UK TeSS Training Portal

Slides:



Advertisements
Similar presentations
ESDS Qualidata and QUADS Coordination Louise Corti Online Resources Day 15 November 2005, London.
Advertisements

OMII-UK Steven Newhouse, Director. © 2 OMII-UK aims to provide software and support to enable a sustained future for the UK e-Science community and its.
Linking Repositories Scoping Study Key Perspectives Ltd University of Hull SHERPA University of Southampton.
Collections and services in the information environment JISC Collection/Service Description Workshop, London, 11 July 2002 Pete Johnston UKOLN, University.
Introduction to the Information Environment Service Registry Amanda Hill MIMAS, The University of Manchester, UK.
A Middleware Registry for the Discovery of Collections and Services Ann Apps MIMAS, The University of Manchester, UK.
A Registry of Collections and their Services: from Metadata to Implementation Ann Apps MIMAS, The University of Manchester, UK.
Disseminating Service Registry Records Ann Apps MIMAS, The University of Manchester, UK.
Content Management System (CMS) - An overview. Project Organisation.
/ department of mathematics and computer science TU/e eindhoven university of technology CEDEFOP workshop: Policy, Practice, Partnership: Getting to Work.
WISE European System for Water Information WISE – part of Eionet (European Environment Information and Observation Network) http//
Faculty of Health & Social Care Shape your own future.
Collections Management News from England + one slide on Project Planning Ben Sullivan General Manager KE Software UK 2007 EMu Users Meeting.
Work Package 3 SEE cluster policy learning platform.
Good practice in Research Data Management Module 6: Tools, training and support.
European Life Sciences Infrastructure for Biological Information TeSS Meeting 1.
European Life Sciences Infrastructure for Biological Information ELIXIR
What is SMEcollaborate Primarily developed for Small and Medium Companies who wish to collaborate together. It is a:- A resource center for collaborating.
Using IESR Ann Apps MIMAS, The University of Manchester, UK.
Presentation by Clare Drew – Goss Interactive Steve Thomson – All Wales Unit.
European Life Sciences Infrastructure for Biological Information Subtask: TeSS Training Portal Subtask lead: Terri Attwood.
IESR-PEPC IESR. PEPC2004, IESR: Providing a Catalogue of Resources for Portals Ann Apps MIMAS, University of Manchester.
The repositories Landscape: where are Repositories now and what’s around the corner? UKDA-store Louise Corti UKDA, University of Essex MIMAS OPEN FORUM.
UK Institutional Repository Search & IESR Vic Lyte & Jo Lambert 23 rd June 2010.
Use & Access 26 March Use “Proof of Concept” Model for General Libraries & IS faculty Model for General Libraries & IS faculty Test bed for DSpace.
VO Sandpit, November 2009 CEDA Metadata Steve Donegan/Sam Pepler.
Formalizing Project EMANI Ithaca, July 26 th, 2002.
Why, why, why DELILA? A program to promote the open sharing of our information literacy and digital literacy teaching material Catherine Robertson – University.
Joint Information Systems Committee Supporting Higher and Further Education Rachel Bruce Programme Manager, JISC Executive Collection.
JISC Information Environment Service Registry (IESR) Ann Apps MIMAS, The University of Manchester, UK.
1 © Xchanging 2010 no part of this document may be circulated, quoted or reproduced without prior written approval of Xchanging. MOSS Training – UI customization.
Windows SharePoint 2007 Introduction. What is Microsoft SharePoint 2007? Microsoft SharePoint 2007 is the central information sharing and collaboration.
Authentication and Authorisation for Research and Collaboration AARC general meeting in Milan, November 3 Authentication and Authorisation.
TeSS Training e-Support Service Niall Beard Aleksandra Pawlik 24/6/14TeSS Workshop, Manchster.
Surveying the landscape: collection-level description & resource discovery JISC/NSF DLI Projects meeting, Edinburgh, 24 June 2002 Pete Johnston UKOLN,
3rd Knowledge Bank Workshop 31 มกราคม 2551 โดย สำนักหอสมุด มหาวิทยาลัยศรี ปทุม
ISMB Demo, 01 July 2009 Franck Tanoh University of Manchester, UK.
The Storage Resource Broker and.
The JISC Information Environment Service Registry (IESR) Ann Apps Mimas, The University of Manchester, UK.
CLARIN EUDAT2020 uptake plan Dieter Van Uytvanck CLARIN ERIC EUDAT User Forum, Rome.
1 Open Discovery Space Overview Argiris Tzikopoulos, Ellinogermaniki Agogi Open Discovery Space [CIP-ICT-PSP ][elearning] A socially-powered and.
AstroGrid & VO Structure NeSC, Edinburgh 21-March-2003 UK Astronomical Data Centres.
International Planetary Data Alliance Registry Project Update September 16, 2011.
Introduction: AstroGrid increases scientific research possibilities by enabling access to distributed astronomical data and information resources. AstroGrid.
E-Infrastructure for Sensitive biomedical data NeiC 2015 Conference Espoo, Finland Antti Pursula.
WORKSHOP ON INFORMATION SYSTEMS ARCHITECTURES Information / software architectures based on Content Management Systems (CMS): some examples with Drupal.
ePortfolio for continuing professional development
ELIXIR TRAINING Professional skills for managing and exploiting data
Nicolas Granier / June 7th
Moving on : Repository Services after the RAE
Promoting Faculty Scholarship through the USFSP Digital Archive
Veritas Content Syndication 2017
Professor Carole Goble University of Manchester, UK
Susanna-Assunta Sansone, Rebecca Lawrence and Simon Hodson
Susanna-Assunta Sansone, Rebecca Lawrence and Simon Hodson
Developing a SDG Reporting Platform – UK perspective
Enhancement of study programs in Public Health Law, Health
WORKSHOP ON INFORMATION SYSTEMS ARCHITECTURES Information / software architectures based on Content Management Systems (CMS): some examples with Drupal.
Martin Moyle Digital Curation Manager UCL Library Services, UK
OpenPSI The web of UK government linked data and reuse within the Research Community.
Publications and Research Data – crosslinking repositories
ESS roadmap on Linked Open Data State of play
Getting the Word Out A Digital Archive for the Intellectual Property of the University of Regina Presented to Deans’ Council October 25, 2006 by Carol.
Information support for the researcher through the Infoportal
European Innovation Platform for Knowledge Intensive Services Elke Van Tendeloo DG Enterprise and Industry Brussels, 04 June 2007.
Disseminating Service Registry Records
JISC Information Environment Service Registry (IESR)
Interlinking standards, repositories and policies
Introduction to the CESSDA Data Management Expert Guide
How to make training materials discoverable
Presentation transcript:

ELIXIR UK TeSS Training Portal https://tess.oerc.ox.ac.uk/ TeSS (Training eSupport System) is a portal for disseminating, discovering and packaging training resources, aggregating information from ELIXIR Nodes and 3rd-party providers. The platform acts as a ‘department store’, where its ‘departments’ (ELIXIR Nodes) promote their latest news and events, and contribute to its catalogue of training materials. The catalogue may be navigated via ‘training workflows’ or relevant materials collected into bespoke training ‘packages’. Aggregate Link Combine TeSS aggregates training resources from ELIXIR nodes and 3rd-party providers Aggregation is done automatically by harvesting materials from providers’ sites, with no or minimal manual intervention Collected training materials can be combined into various training packages and training workflows TeSS is not a repository – it does not store the actual training materials TeSS stores links to content providers’ training materials with appropriate attribution Other registries TeSS Link Link Link  CTCTCACTGAATCAGTACCAAATGCACTCACAT MNATDAVLGAAILAGTACVSNATHWQFAAVL Link Content Providers Aggregate Combine Combine Training Materials Training Packages Training Workflows Training resources, news and events specific for ELIXIR Nodes TeSS aims to provide an at-a-glance view of the ELIXIR training landscape, while also offering individual ’shop windows’, giving customisable views of the hottest training news, events, activity highlights, etc. from ELXIR nodes, as well as a more general view of training materials from selected non-ELIXIR providers. Linking Up With Other ELIXIR Nodes Training materials can be linked to relevant services, datasets and tools from ELIXIR Denmark’s Tools and Data Services Registry, Web services from ELIXIR UK’s BioCatalogue and data policies and standards from ELIXIR UK’s BioSharing. Lead organisations Collaborators University of Manchester Terri Atwood, Carole Goble Niall Beard, Aleksandra Nenadic University of Oxford Susanna-Assunta Sansone, Milo Thurston EMBL-EBI GOBLET UCL TGAC CBS DTU tess@elixir-uk.info https://tess.oerc.ox.ac.uk/ @ElixirTess