The Central Dogma Transcription & Translation

Transcription and Translation 8/24/2018 The “Central Dogma” of Molecular Genetics Transcription Translation DNA RNA Protein Trait RNA processing G. Podgorski, Biol 1010

Transcription and Translation: An Overview (aka the Central Dogma)

Transcription DNA RNA What is the difference between DNA and RNA? Ribose Sugar Uracil not thymine

RNA vs. DNA DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U Both contain a sugar, phosphate, and base.

Transcription and Translation 8/24/2018 RNA Is Largely Single-Stranded G. Podgorski, Biol 1010

Transcription and Translation 8/24/2018 There are Different RNAs with Distinct Functions Recently, a new class of RNA, microRNA, has been shown to regulate gene expression. G. Podgorski, Biol 1010

Transcription Where? What? When? Why? How? Nucleus in Eukaryotes Cytosol in Prokaryotes What? RNA Polymerase plus some minor proteins When? When RNA is needed Why? RNA’s serve many important functions in cells How?

Transcription The transcriber is RNA polymerase. It binds to one DNA strand at a site called the promoter It then moves along the DNA pairing complementary Nucleotides. It disengages at a stop signal

Transcription and Translation 8/24/2018 Transcription is a Key Step in Gene Expression Transcription makes an RNA copy of DNA. G. Podgorski, Biol 1010

TRANSCRIPTION DNA - RNA ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU

Transcription and Translation 8/24/2018 RNA polymerase acts here The enzyme RNA polymerase opens the DNA strands and synthesizes an RNA complementary to only one of the DNA strands. G. Podgorski, Biol 1010

Transcription and Translation 8/24/2018 Transcription A gene The decision to transcribe a gene is the most important step in the control of gene expression. Transcription starts and stops at distinct sites at the ends of a gene. Animation G. Podgorski, Biol 1010

Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

Translation Second stage of protein production mRNA is on a ribosome

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases

Transcription and Translation 8/24/2018 The Genetic Code is Biology’s Rosetta Stone These are the words of the genetic language. G. Podgorski, Biol 1010

Transcription and Translation 8/24/2018 The Genetic Language Uses 4 Letters Written Into 3-Letter Words G. Podgorski, Biol 1010

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end complements mRNA codon

Transcription and Translation 8/24/2018 tRNA Is An Adpator That Couples Codons and Amino Acids G. Podgorski, Biol 1010

Transcription and Translation 8/24/2018 Eukaryotic Genes are Segmented Genes are made of parts represented in the mRNA (exons) and parts that are transcribed but not present in the mRNA (introns). Introns are removed from the primary transcript and exons are spliced together to make mRNA. In some genes more than 90% of the pre-mRNA is destroyed, never to appear in the mRNA. Animation G. Podgorski, Biol 1010

Transcription and Translation 8/24/2018 What Translation Accomplishes The sequence of amino acids determines the structure, and therefore the function, of a protein. In translation, information present in the mRNA is read by the ribosome to synthesize a polypeptide. G. Podgorski, Biol 1010

DNA RNA Protein Cytoplasm Nucleus

Nucleus Cytoplasm

Genetic information usually flows in one specific direction Genetic information usually flows in one specific direction. Which of the following best represents this flow? A. DNA to Protein to RNA B. Protein to RNA to DNA C. RNA to Protein to DNA D. DNA to RNA to Protein