Nucleic Acids These are one of our 4 large biomolecules 1. Carbohydrates 2. Lipids 3. Proteins 4. Nucleic Acids

Organisms are made up of cells. All cells run on a set of instructions known as nucleic acids. Cells DNA

The two types of nucleic acids: DNA RNA

What does DNA stand for? Deoxyribo Nucleic Acid Deoxyribonucleic acid: is the hereditary material in humans and almost all other organisms. Every cell in a person's body has the same DNA.

Where inside your cells is DNA found? In eukaryotes: it is found inside the Nucleus. In prokaryotes: it is found free floating in the cytoplasm.

Who was it that discovered DNA’s shape? Watson and Crick. What year do you think they founded It? 1953

Does anyone remember the shape of DNA?

DNA is known as a Double Helix or Double Stranded.

Each nucleic acid is made up of smaller units (monomers) called Nucleotides.

Each Nucleotide is composed of 3 things: Phosphate group Ribose (5 carbon) sugar Nitrogen Base

How does DNA hold itself together? It is held together by 4 Nitrogenous bases bonded by weak hydrogen bonds: Adenine bonds with __________ Cytosine bonds with __________

There are 2 Types of Nitrogenous Bases: 1. Purines: Adenine and Guanine (AG’s are pure) 2. Pyrimidines: Thymine and Cytosine Adenine Thymine A T Guanine Cytosine G C

How do cells make new copies of DNA for new cells? Replication: 1. When DNA needs to be copied, it unwinds in the nucleus 2. An enzyme, DNA Helicase, starts to “unzip” the DNA making a replication fork. 3. As DNA is unzipped, another enzyme, DNA Polymerase, begins to add nucleotides to the now exposed bases of the old strand. 4. The two new DNA identical strands are produced.

Challenge Question If we all have the same DNA, how come we all have different traits?

Answer: The order of our nucleotides helps determine our traits. Ex: ACC-TAG-CCA-TAA could express one gene while TAG-ACC-CCA-TAA could express another gene.

DNA Replication Practice A codon is made up three nitrogen bases. Original DNA: TTA ATT CGC GCC CTG GAT Complementary DNA:

Structure of RNA ( Ribonucleic Acid)

Structure of RNA ( Ribonucleic Acid) Components of RNA: Phosphate Ribose Sugar Uracil bonds with Adenine Guanine bonds with Cytosine

RNA ( Ribonucleic Acid) RNA is found in the nucleus of cells. RNA travels from the nucleus of a cell to the ribosome in a cell. The monomer of a nucleic acid is a Nucleotide.

DNA vs. RNA DNA Differs from RNA DNA has a sugar called RNA has a sugar Deoxyribose ribose DNA has thymine (T) RNA has uracil (U) DNA is double-stranded RNA is single-stranded DNA stays in the nucleus RNA leaves the nucleus and travels to the ribosome.

Like this! What happens when an error happens? G C T DNA Polymerase “proofreads” the new strands of DNA and corrects errors.

DNA “codes” for Proteins,…….. But How? Protein Synthesis (to make) By the process of Transcription which is the conversion of DNA into mRNA.

Transcription 1.Transcription occurs in the nucleus, but the Messenger RNA (mRNA) leaves the nucleus. 2. It attaches to a Ribosome which begins to read the mRNA. 3. It reads three (3) letters at a time.

Matching bases of DNA & RNA U instead of T is matched to A DNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA

Protein Synthesis Lets Review the first Two Steps of Protein Synthesis: 1. Replication 2. Transcription

Replication vs. Transcription DNA Replication is the process where a DNA makes a copy of itself before cell division Transcription is where only a small piece of DNA is transcribed (re-written) as a single strand of mRNA A transcript is a “written message” Special enzymes break the hydrogen bonds apart DNA “bubbles” in certain sections when this occurs. Strand of mRNA

DNA Replication- when DNA splits and both sides are used to make 2 identical copies of DNA! Transcription- where a small section of DNA is used to form mRNA prior to protein synthesis! mRNA

Why Transcription? DNA cannot leave the nucleus… EVER (too big!) However, proteins are made by the ribosomes inside of cells, not the nucleus! To get the DNA instructions to the ribosomes, the message is sent out on a piece of mRNA (through the nuclear pores!) Once the ribosomes get the mRNA, they can translate the message and build the proteins! 5’ UAU CGC UAG CAU GAG CUC GCC AAA GAU 3’

A lot like replication, only you use U’s rather than T’s! Making an mRNA A lot like replication, only you use U’s rather than T’s! 5’ TAA CGG TAT CAG 3’-DNA original 3’ AUU GCC AUA GUC 5’ –mRNA copy

Translation The process of reading the mRNA code and making Proteins is called:Translation “Translate” means to decode During translation, the instructions in mRNA are decoded to build a protein This happens one amino acid at a time (Remember- amino acids are the building blocks of proteins!) Ex: “CGC” codes for the amino acid “Arginine”

Here is the Codon Table

for the amino acid “Arginine” Step One-Translation First, the mRNA threads itself into the grooves of the ribosome (the protein makers) Every three bases is called a codon, which translates into one amino acid. Ex: “CGC” codes for the amino acid “Arginine” codons

Step Two-Translation For example: A tRNA carries the amino acid “Arginine” over to the ribosome The ribosome recognizes the tRNA because of a complimentary anti-codon on the bottom (looks like a little 3 prong plug!) The ribosome attaches amino acids to the rest of the protein chain until it gets to a STOP codon (ex: UAA, UAG, etc)

Translation “Big Picture”

Protein Synthesis Synthesis (or synthesize) means “to make or build something” The process where amino acids are linked together to make protein chains is called protein synthesis. Ribosomes synthesize these proteins based on base pairs of the mRNA There are 20 Amino Acids in all!

This portion of DNA translates into what amino acid sequence? DNA original- 5’ TAC CGG TGA CAT GAC 3’ mRNA- 3’ AUG GCC ACU GUA CUG 5’ Amino Acids- methionine, alanine, threonine, valine, leucine

Amino Acid Translation Chart!

The process of reading the mRNA code and making Proteins is called: Translation The Ribosome doesn’t just read the mRNA, it calls for Amino Acids for each Codon it reads. U G C Hey! I need a Cysteine!! The codon “U G C” calls for the amino Acid Cysteine. A little help here?

The Ribosome moves down the mRNA and calls for the next Amino Acid U G C A C G A C G U G C The first tRNA goes away when the second amino acid is attached to the first with a Peptide bond Then the ribosome moves to the next Codon Cysteine Threonine

A C G U G C Cysteine Threonine

Proteins ALWAYS start with Methionine. Proteins ALWAYS end with stop. At the “STOP” codon, the ribosome releases the mRNA and the Amino Acid Chain. Proteins ALWAYS start with Methionine. Proteins ALWAYS end with stop.

Mutations Any change in a DNA sequence is a mutation. Mutations that affect body cells are not passed on to offspring, but may harm the individual.

Types of Mutations Point – change in one single base pair of DNA Frame shift – a single base is added or deleted,

Answer: Gene expression and nucleotide sequence. What? Gene expression determines which traits are expressed. Not all of our genes are expressed. Some are turned on and some are turned off. The order of our nucleotides also helps determine our traits.