12.3 Assessment Answers.

Slides:



Advertisements
Similar presentations
Nucleic Acids and Protein Synthesis
Advertisements

TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.
8.4 DNA Transcription 8.5 Translation
Protein Synthesis Chapter 11.
Transcription.
Chapter 13: RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.
RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.
Protein Synthesis Process that makes proteins
Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.
RNA AND PROTEIN SYNTHESIS
RNA Another Nucleic Acid.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.
Structure of DNA DNA is made up of a long chain of nucleotides
RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.
12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.
RNA and Protein Synthesis
Ribosomes and Protein Synthesis
copyright cmassengale
Protein Synthesis Translation.
CH 12.3 RNA & Protein Synthesis.
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA Another Nucleic Acid.
12-3 RNA & Protein Synthesis
How to Make a Protein?.
PROTEIN SYNTHESIS.
RNA Another Nucleic Acid.
13.3 RNA & Gene Expression I. An Overview of Gene _____________ A. RNA
From DNA to Proteins Transcription.
13.3 RNA & Gene Expression I. An Overview of Gene Expression A. RNA
Gene Expression Continued
RNA Another Nucleic Acid.
Protein Synthesis Standards:
Protein Synthesis.
Transcription and Translation
RNA Ribonucleic Acid.
How DNA and RNA make Proteins.
Chp: 12 Transcription & Translation
PROTEIN SYNTHESIS.
RNA and Protein Synthesis
copyright cmassengale
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Central Dogma
RNA - TRANSLATION.
Protein Synthesis.
Protein Synthesis RNA.
Transcription/ Translation Notes 16-17
Unit 7: Molecular Genetics
Steps of Translation.
RNA.
How does DNA create action?
Genes and Protein Synthesis Review
RNA & Protein synthesis
The Central Dogma … From DNA to proteins.
DNA Replication Living Environment 2015.
Protein Synthesis.
DNA Notes Section 12.3.
PROTEIN SYNTHESIS.
Protein Synthesis.
Protein Synthesis.
Protein Synthesis Chapter 10.
Do Now Describe the three types of RNA.
DNA → RNA→ Protein Sec. 12.3, DNA, RNA, and Protein
Protein Synthesis.
Presentation transcript:

12.3 Assessment Answers

What is the central dogma of biology? DNA codes for RNA, which guides protein synthesis What does it have to do with protein synthesis? DNA is the guide for making proteins

2. What is produced in transcription and translation 2. What is produced in transcription and translation? In transcription, mRNA In translation, proteins

3. Since RNA is important in transcription and translation, describe what it is made of? single stranded alternating phosphates and the sugar ribose uses the base uracil in place of thymine

4. Describe the three types of RNA 4. Describe the three types of RNA. Include shape, location, any movement of the RNA, and which process transcription /translation it is involved in. mRNA- made in nucleus in transcription and then leaves to go to the cytoplasm rRNA – in cytoplasm, made of two units that come together during translation to interpret mRNA code tRNA – in cytoplasm, looks like a cloverleaf, carries anticodon and amino acid used in translation

5. In transcription, what enzyme is used to make the new strand of mRNA? RNA polymerase What happens to the new mRNA after it is produced? Leaves the nucleus and goes to cytoplasm

6. Is mRNA made from both sides or one side of the DNA? Only one side 7. How many amino acid are there? Only 20 How are proteins made? Combining amino acids to each other in a long chain

8. What is the definition of the genetic code 8. What is the definition of the genetic code? The language of mRNA How many letters are read at a time on the mRNA? 3

9. What is a codon? Where is it found? three letter word in mRNA List the start and stop codons. Start-AUG Stop - UAA, UGA, or UAG

11. Describe the function of tRNA 11. Describe the function of tRNA. Interprets the language of mRNA and brings amino acids to make proteins What are the two things that are located on tRNA? Anticodons and amino acids

12. What is the anticodon complementary to on the mRNA. The codon 13 12. What is the anticodon complementary to on the mRNA? The codon 13. What happens to the amino acids that the tRNA brings to the mRNA? They bond to each other to make proteins

14. What happens to mRNA, tRNA, rRNA and the protein when a stop codon is reached on the mRNA? Since there is no tRNA complement to these codons, The rRNA, tRNA, and mRNA disassembles and the protein chain is released. Protein synthesis is ended.

15. Using the chart in the textbook, what amino acid is coded by the codon AUG? Methionine 16. Write the sequence of mRNA codons for the following amino acid chain: start-serine-histidine-tryptophan-stop. AUG-UCU(UCC, UCA, UCG)-CAU(CAC)-UGG-UAA(UAG, UGA)

17. Indicate where transcription and translation occur in prokaryotic and eukaryotic cells. Eukaryote – transcription in nucleus, translation in cytoplasm Prokaryote – transcription and translation in cytoplasm

18. Describe how DNA accounts for the similarities among all human beings? Similar sequences of DNA make up genes 19. What accounts for the differences between individuals? Unique sequences of DNA that make up genes

20. Suppose you are going to build a car at an automobile factory 20. Suppose you are going to build a car at an automobile factory. You would need to make blue prints first to indicate the design of the car. Comparing the building of proteins to that of a car, use the words cytoplasm DNA (genetic code), mRNA, rRNA, tRNA, protein and ribosome to fill in the answers to the analogy below: Automobile Factory Protein Synthesis Engineers/blueprints a. Workers (who) b. Supplier (who) c. Factory floor (where) d. Assembly line (where) e. Car (what) f. DNA mRNA, rRNA tRNA cytoplasm ribosome protein