Mutations Bio.3.1.3 Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Slides:



Advertisements
Similar presentations
Mutations. Definition mutation A mutation is a change in an organism’s DNA – Silent mutations are changes that do not result in a change to the organisms.
Advertisements

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.
14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.
Mutation and Genetic Change
Mutations are changes in DNA that may or may not affect phenotype.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
MUTATIONS.
Mutations Chapter 12.4.
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.
Mutations that happen during Transcription and Translation
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
MUTATIONS No this can’t happen with just mutations.
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
Mutations.
The Cell Cycle.
May occur in somatic cells (aren‘t passed to offspring)
Gene Expression and Regulation and Mutations
Section 11.3: Genetic Changes
Genetics Lesson 4 Mutations.
Mutations and Nature vs. Nurture.
Lecture 55 Mutations Ozgur Unal
Mutations.
A change in the DNA sequence that affects genetic information
Mutations.
A mutation is a change in an organism’s DNA.
Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mermaid Syndrome Video.
Copyright Pearson Prentice Hall
A change in the DNA sequence that affects genetic information
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
11.3 Section Objectives – page 296
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Some mutations affect a single gene, while others affect an entire chromosome.
Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.
Mutations.
MUTATIONS.
A mutation is a change in an organism’s DNA.
SB2. The learner will analyze how biological traits are passed on to successive generations. d. Describe the relationships between changes in DNA and potential.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations Good intro video
DNA Mutations.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Copyright Pearson Prentice Hall
A mutation is a change in an organism’s DNA.
11.3 Section Objectives – page 296
A mutation is a change in an organism’s DNA.
Mutations.
Presentation transcript:

Mutations Bio.3.1.3 Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations in existing genes lead to changes in function and phenotype

Types of Mutations Gene mutations are changes in one or more of the nucleotides in a gene. Germ-cell mutations occur in gametes and can be passed on to offspring. New traits, no changes, birth defects, genetic diseases Somatic-cell mutations occur in body cells and affect only the individual organism. No effect on cell, cell dies, cell becomes cancerous Chromosome mutations are changes in the structure of a chromosome or the loss or gain of an entire chromosome.

Gene Mutations - Point Mutations One nucleotide changes (called a base substitution) changes only one amino acid (if any!) Silent mutations code for the same amino acid

CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate CACGTGGACTGAGGACACCTC Codon for CAC = valine What does it matter??? Changing one amino acid changes the shape of the protein which can change how it functions

Gene Mutation - Frameshift Mutation a single base is added or deleted changes every amino acid after the mutation site - also called a nonsense mutation because the protein is so different it can’t function

Chromosome Mutations Chromosome mutations are changes in the structure of a chromosome or the loss or gain of an entire chromosome. Inversion – a piece of the chromosome rotates Deletion – losing part of a chromosome Insertion – adding part of a chromosome Translocation – a piece of chromosome changes place with a piece on another chromosome (two deletions and two insertions)

What can cause a mutation? A mutation can be inherited, caused by environmental agents, or happen spontaneously Mutagen – anything environmental that can cause a change in DNA

Mutagens Radiation – UV, X-rays, nuclear

Mutagens Chemicals – asbestos, formaldehyde, chemicals in tobacco products (many mutagens are also carcinogens – cancer causing)

Mutation Repair Note: Our DNA mutates all the time, but our cells have repair mechanisms. It is the overexposure to a mutagen that causes the worst problems, because the cell cannot repair all of it in time. Also, repair effectiveness reduces with age.