(3) Gene Expression Gene Expression (A) What is Gene Expression? (E) Splicing and post-translational modification (B) Structure and Functions of RNA (D) Translation (C) Transcription

Gene Expression (D) State where translation occurs State what mRNA is translated into State what is meant by an ‘anti-codon’ State 2 features of the tRNA folded structure Explain briefly how the sequence of amino acids is formed Describe the process of translation State where start and stop codons are found and what their functions are Name the bond formed between amino acids State what happens to tRNA molecules as the polypeptide chain is formed during translation

Codons Codons are the basic unit for the genetic code Bases are taken in groups of 3 giving 64 (43) different combinations. Each amino acid is coded for by one of these 64 triplets of bases

Structure of tRNA (2D vs 3D)

Structure of tRNA tRNA molecules are shaped like a four leaf clover so that: One side can bind to mRNA ( anti- codon) Second side binds to ribosome Third side binds to a specific amino acid Fourth side binds to enzymes controlling the process

tRNA The tRNA molecule folds up due to base pairing. By doing so, it forms: A triplet anticodon site (this is where the complementary codon will match up with it) An attachment site for a specific amino acid. The anti-codon on a tRNA molecule corresponds to a specific amino acid. There are 20 different types of amino acids, therefore there are also 20 types of tRNA molecules. AA 1 G C U ANTI-codon

Translation – Importance of Sequence Triplet codons on mRNA and anticodons on the tRNA translate the genetic code into a sequence of amino acids. This sequence of amino acids dictates the structure of the protein to be made

Cell Ultra structure Ribosomes Site of protein synthesis

Ribosomes Found freely in the cytoplasm AND on the ROUGH endoplasmic reticulum Translation of mRNA into a polypeptide by tRNA occurs at the ribosome.

Pathway to making a protein DNA RNA Protein a mRNA molecule is made (transcribed) from a portion of DNA and then carried to the cytoplasm transcription translation occurs when the sequence of bases of mRNA DIRECTS the sequence of amino acids in a protein RIBOSOME – site of protein synthesis Translation ANIMATION

Peptide bond forms between amino acids Amino Acid U G C aa2 tRNA bringing in specific amino acid to the ribosome A U aa7 tRNA bringing in specific amino acid to the ribosome Codon anticodon link Codon on mRNA AntiCodon on tRNA U A C G mRNA

tRNA returning to cytoplasm for another amino acid aa4 aa3 A U aa7 C G U aa5 U C A aa6 U A U C C U U G C tRNA returning to cytoplasm for another amino acid aa2 Peptide bond forms between amino acids U G A aa9 aa7 U G C aa2 A U U A C G

aa4 aa3 A U aa7 C G U aa5 A U C aa6 U A U C C U aa2 U G C aa2 aa7 U G A aa9 U G C U A C G

A U aa7 U aa4 aa3 C G U aa5 U C C U aa2 U G C A U C aa6 aa2 aa7 aa9 U G A U A C G

To see an excellent animation of this from DNA tube click here aa7 aa3 G U C aa5 U C C U aa2 U G C To see an excellent animation of this from DNA tube click here U aa4 aa6 aa2 aa7 aa9 A U C U A C G

Translation Step 1: The mature mRNA transcript enters the cytoplasm and attaches to a ribosome The mRNA transcript contains a start codon and stop codon Translation always occurs in the 5’ to 3’ direction

Translation Step 2: tRNA molecules pick up specific amino acids in the cytoplasm

Translation Step 3: tRNAs carrying amino acids align their anticodon beside the complementary codon on the mRNA

Translation Step 4: Peptide bonds form between adjacent amino acids The tRNA molecule leaves the ribosome and return to the cytoplasm (where it can pick up more of the specific amino acids if required)

Translation Step 5: the polypeptide chain continues to grow Poly = many; peptide = the bond formed between 2 AAs

Translation Step 6: Eventually, a stop codon on the mRNA is reached. This is when the polypeptide becomes released from the ribosome

VIDEO: translation

Start and Stop Codons In human cells the START codon is always AUG which codes for the amino acid (Met/M) Methionine . There is also a ‘stop’ codon which completes the process

Start and Stop Codons GCGTTTGAAGATGATCAGTTAGAAACT TASK: Write the correct sequence of Amino Acids which would translated from the following DNA strand: GCGTTTGAAGATGATCAGTTAGAAACT mRNA: CGCAAACUUCUACUAGUCAAUCUUUGA Amino acid that is carried by the tRNA: STOP Arginine Leucine Lysine Leucine Valine Leucine Leucine Asparagine

Gene Expression (D) State where translation occurs State what mRNA is translated into State what is meant by an ‘anti-codon’ State 2 features of the tRNA folded structure Explain briefly how the sequence of amino acids is formed Describe the process of translation State where start and stop codons are found and what their functions are Name the bond formed between amino acids State what happens to tRNA molecules as the polypeptide chain is formed during translation