1Department of Esoteric Testing/R&D, Tampa General Hospital, Tampa, FL 2Special Clinical Microbiology Laboratory (LEMC), Federal University of São Paulo/UNIFESP ASM 2016 Microbe Annual Meeting Monday-119 Detection of Rapid Growing Mycobacterium Directly from Clinical Samples Using the Open Mode System of the BD MAX™ Platform Talita T Rocchetti2, Suzane Silbert1, Carly Kubasek1, Alicia Gostnell1, Antonio C C Pignatari2, Raymond Widen1 talita.rocchetti@lemc.com.br Amended Abstract Methods Results Table 2. BD MAX Results for M. abscessus group Mycobacterium chelonae (MC), M. abscessus group (MAG) and M. fortuitum complex (MFC) are the most common rapid growing mycobacteria isolated from respiratory infections. The aim of this study was to validate a new laboratory developed multiplex PCR test to detect MC, MAG and MFC directly from clinical samples using the open mode system of the BD MAX™ platform. Methods: A total of 197 clinical samples previously submitted for mycobacterial culture, were tested using the new multiplex PCR test. Before testing, samples were treated with Proteinase K at 60°C for 30 minutes and heated at 95°C for 5 minutes. After this pretreatment step, each sample was inoculated into the BD MAX Sample Preparation Reagent Tube. Extraction and multiplex PCR were performed by the BD MAX™ system, using the BD MAX™ ExK™ TNA-3 extraction kit and BD MAX TNA MMK™ Master Mix, along with specific in-house designed primers and probes for MC, MAG, MFC and Beta Globin (BG, internal control) detection. One set of common forward and reverse primers and distinct probes for MC and MAG detection were designed using the ITS region. For MFC, 2 forward and 1 reverse primers, as well as 1 probe were designed using the rpoB gene. Cycling conditions were: 80°C for 10 min and 40 cycles of 95°C for 15s and 60°C for 60s. The Limit of Detection (LoD) of each target was evaluated by testing a serial of seven 10-fold dilutions of 4 different species of mycobacteria (1 MC, 1 MAG and 2 MFC). Specificity was carried out by testing different species of mycobacteria (n=26), aerobic bacteria (n=19) and Candida (n=7) commonly found in respiratory infections. Results: Out of 197 clinical samples included, 133 were positive, 60 were negative for mycobacteria by culture and 4 negative samples were spiked with M. chelonae ATCC 35752. Among culture positive samples, the new PCR was able to identify 4 out of 5 MC, 26 out of 29 MAG and all six MFC. Three samples negative for mycobacteria by culture were positive for MAG by PCR. All 60 samples identified as negative by culture were also identified as negative by the new multiplex PCR test. The LoD was 101 CFU/mL for MC, 101 CFU/mL for MAG and 102 CFU/mL for MFC. The new multiplex PCR was specific and correctly identified the species correspondent to each PCR target. Conclusion: The new multiplex PCR test performed on the BD MAX System proved to be a sensitive and specific test to detect MC, MAG and MFC by real-time PCR on an automated sample-in results-out platform. A total of 197 clinical samples were included in this study. Out of them, 133 were previously identified as positive and 60 as negative for Mycobacterium species by culture, and 4 negative samples were spiked with M. chelonae ATCC 35752. A common primer pair for MAG and MC and two specific probes, one for each species, were designed using the Internal Transcribed Spacer (ITS) gene. For MFC, 2 forward and 1 reverse set of primers, as well as 1 probe were designed using the rpoB gene (Figure 1). Specificity was carried out by testing different species of aerobic bacteria (n=19) and Candida (n=7) commonly found in respiratory infections, as well as different species of mycobacteria (n=26), including 3 MAG subspecies and 10 species of MFC (Figure 1). The limit of detection (LoD) was determined by a serial of seven 10-fold dilutions prepared in ultra-pure water (Sigma-Aldrich, Co. Ltd, Saint Louis, US) from a 0.5 McFarland (1.5 x 108 CFU/mL) suspension of the following ATCCs strains: M. abscessus ATCC 19977; M. chelonae ATCC 35752; M. fortuitum ATCC 6841 and M. houstonense ATCC 49403. Samples were pretreated with 25 μL of Proteinase K at 60°C for 30min and 95°C for 10min. After that, 250 μL of the sample was inoculated in the BD Sample Preparation Reagent Tube. DNA extraction and multiplex PCR were performed on the BD MAX™ System using the BD MAX™ ExK™ TNA-3 extraction kit, the BD MAX™ TNA MMK Master Mix, and the specific primers (1.8 µM) and probes (0.4 µM) for MC, MAG, MFC, and Beta Globin (BG, internal control) detection. Cycling conditions were performed at 80°C for 10min and 42 cycles of 95°C for 15s and 60°C for 60s. Results were analyzed using the BD MAX™ software. Discordant result samples were tested by an in-house PCR (qPCR) for M. chelonae/abscessus and MFC detection using melting curve analysis. BD MAX Results for MAG The new RGM multiplex BD MAX PCR was able to detect MAG in 29 samples; 26 of them were also positive by culture (Table 2). Additionally, the new RGM multiplex PCR detected 4 out of 5 MC positive samples (Table 3) and all 6 culture positive samples for MFC (Table 4). Discrepant results between culture and PCR were observed in 7 samples (Table 2 and 3) All these 7 discrepant samples were tested by an in-house qPCR for MAG and MC detection using melting curve analysis. Results from 6 of them (5 MAG and 1 MC) were in agreement with the results from the new RGM multiplex BD MAX PCR. The last sample, however, was MAG positive by culture and qPCR, and negative by the new RGM multiplex BD MAX PCR. This sample was frozen for a long period of time before testing on the BD MAX, and was also reported smear negative suggesting low bacterial load in the sample. The new RGM multiplex BD MAX PCR presented a LoD of 101 CFU/mL for MC and MAG and 102 CFU/mL for MFC. Moreover, the new RGM multiplex BD MAX PCR was specific, did not present cross reactivity to related organisms and correctly identified the species correspondent to each PCR target. Culture Results For MAG Positive Negative 26 3 165 Table 3. BD MAX Results for M. chelonae BD MAX Results for MC Culture Results for MC Positive Negative 4 1 192 Table 4. BD MAX Results for M. fortuitum complex BD MAX Results for MFC Culture Results for MFC Positive Negative 6 191 A - MC MAG : 1 2 3 4 5 6 __________________________________________________________ 7 B MFC: 8 9 10 11 12 13 14 15 16 17 Pb MAG M. abscessus M. massiliense bol l etii CY5 Pb M C PF PR FAM MFC PF1 PF2 JOE ITS gene rpoB gene M. porcinum M. houstonense M senegalense M. farcinogenes M. boenickei M. fortuitum M. peregrinum M. neworleansense M. septicum M. alvei CONCLUSIONS Table 1: Primers and probes used for the new RGM multiplex BD MAX PCR The new RGM multiplex BD MAX PCR displayed high correlation with culture for the detection and identification of M. abscessus group, M. chelonae and M. fortuitum complex. The probe designed for M. abscessus detection was able to identify different subspecies from M. abscessus group, including M. abscessus, M. massiliense and M. bolletii. M. fortuitum complex probe was also very efficient and able to identify the 10 most common pathogenic species of MFC. The new RGM multiplex PCR assay developed on the BD MAX open system is a great alternative test for detection and identification of MC, MAG and MFC. This test can also provide same day results, while traditional culture results might take up to 30 or more days to be reported. Target Sequence (5’ to 3’) Gene MFC PF 1 : ACCTGACCTGCACAAAGT rpoB PF2: TCACCTGATCTGCACATAATGT PR: AGCACCTCATGCGACTT Pb: FAM CTAGCCTGA GCRTTGCTCAGCA BHQ1 MC - MAG PF: CACGGGGTGGACAGGATTTA ITS TAAGGAGCACCATTTCCCAG Pb Cy5 ATTCACCAAGCGAGTAACCA JOE TCACCAAGTAGATAYCCACTACAGA BG GCAAGGTGAACGTGGATGAA Beta Globin AACCTGTCTTGTAACCTTGATACCAA Quasar 705 TTGGTGGTGAGGCCCTGGGC BHQ3 Introduction The most common pathogenic rapid growing mycobacteria (RGM) are: M. chelonae (MC), M abscessus group (MAG) and M. fortuitum complex (MFC). Rapid identification of these species is recommended to guide an effective antibiotic treatment. The aim of this study was to develop a multiplex PCR test to detect MC, MAG and MFC directly from clinical samples using the open mode system of the BD MAX platform. Figure 1: Multiplex set of primes and probes.