Honors Biology Chapter 12 Molecular Genetics

Identify key historical findings in the pursuit of the structure of DNA. Draw and label a diagram of the molecular structure of DNA, showing the relationships between the six essential molecules that make up DNA: deoxyribose, phosphate, adenine, cytosine, guanine, thymine. Apply knowledge of complementary base pairing to predict a DNA strand sequence given information about the other DNA strand.

What IS the physical “factor” identified by Mendel? How do “factors” produce phenotypes? What is the molecular basis for the “genetic code?” Scientists could narrow it down to molecules found in the nucleus: DNA, RNA, or protein? Most thought proteins, because they’re much more diverse and complex

Griffith’s Transformation Working with pneumonia in 1928, Griffith transformed or changed bacteria from one form to another.

Avery’s Experiments What is the “transforming factor”? Avery used enzymes to destroy molecules from the heat killed cells before transforming harmless cells. Concluded: DNA is the transforming factor.

Hershey-Chase Experiment Alfred Hershey & Martha Chase: Radioactively label viral protein vs. DNA, let the phages infect bacteria, then separate them Bacteria had the DNA trace, not the protein trace

Rosalind Franklin & Photo 51 Franklin used X-ray diffraction to photograph crystallized DNA molecules. Showed the helical shape and repeating structure of DNA

The Double Helix In 1953, James Watson and Francis Crick used scientific evidence reported by other scientists to suggest a model for the DNA structure as a double helix

Information molecules Nucleic Acids Information molecules Examples DNA Deoxyribonucleic Acid RNA Ribonucleic Acid RNA

Nucleic Acids Function: genetic material stores information blueprint for building proteins DNA  RNA  proteins transfers information blueprint for new cells blueprint for next generation DNA proteins

Nucleic acids 5 different nucleotides Building block = nucleotides nucleotide – nucleotide – nucleotide – nucleotide 5 different nucleotides different nitrogen bases A, T, C, G, U Nitrogen bases I’m the A,T,C,G or U part! phosphate sugar N base

4 Types of Nitrogenous Bases in DNA Purines: have 2 rings (Adenine and Guanine) Pyrimidines: have 1 ring (Thymine and Cytosine)

Complementary Base Pairing Chargaff’s Base Pairing Rule: Chargaff determined that the amount of Adenine = amount of Thymine, and the amount of Guanine = the amount of Cytosine. The bases are connected to each other in the double helix by hydrogen bonds. A pairs with T C pairs with G

DNA Double strand twists into a double helix Hydrogen bonds between nitrogen bases that join the 2 strands are weak the two strands can separate and reattach with relative ease It’s a helix or B sheet within a single region. Can have both in one protein but a specific region is one or another

Describe and model the process of DNA replication, including an explanation of why it produces identical copies of DNA.

Copying DNA A dividing cell replicates (i.e. duplicates) its DNA in S phase creates 2 copies of all DNA (sister chromatids) separates the 2 copies to 2 daughter cells DNA cell nucleus

Copying DNA Matching bases allows DNA to be easily copied

DNA Replication Steps: DNA starts as a double-stranded molecule matching bases (A:T, C:G) Then the helix untwists and…

DNA replication Strands “unzip” at the weak bonds between bases Done by an enzyme, helicase

DNA replication Enzyme DNA polymerase DNA bases in nucleus Enzyme DNA polymerase matches free-floating bases to exposed strand DNA polymerase

New copies of DNA Get 2 exact copies of DNA to split between new cells, thanks to complementary base pairing Each copy = one original strand, one new strand DNA polymerase DNA polymerase

DNA Replication-Review This process is responsible for the formation of sister chromatids, and their characteristic X shape Copying DNA

double-stranded human chromosomes ready for mitosis

From Gene to Protein

Compare and contrast DNA and RNA. Explain and model the overall process of protein synthesis (transcription and translation). Apply knowledge of transcription to predict an mRNA sequence given information about a DNA sequence.

DNA  Proteins  Cells  Bodies DNA gets all the glory, Proteins do all the work

What do we know? DNA Proteins DNA = instructions for proteins proteins run living organisms enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins

Protein Synthesis: Part 1 So… How does the cell get the instructions from the nucleus to the ribosomes? CELL CYTOPLASM NUCLEUS RIBOSOMES – where proteins are made DNA – stores info to make proteins mRNA Where are the instructions to make proteins? Where are proteins made? It makes a copy to send called – messenger RNA

Flow of Genetic Information 1. A gene or segment of DNA is located on a chromosome 2. The cell uses transcription to copy the gene into a piece of mRNA 3. The mRNA leaves the nucleus and goes to a ribosome 4. The ribosome uses translation to direct the assembly of a protein 5. Gene is now expressed in the cell

RNA = Ribonucleic Acid Structure: Types: Made of a single strand of nucleotides Nucleotides use Ribose instead of Deoxyribose Nitrogen base thymine is replaced by Uracil Types: Messenger RNA (mRNA): single stranded- used to carry DNA code out of nucleus “working copy” Transfer RNA (tRNA): binds to specific amino acids, used to build proteins Ribosomal RNA (rRNA): makes up ribosomes along with proteins

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T = thymine T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U = uracil U : A C : G single stranded

DNA vs. RNA DNA RNA DNA

Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

Transcription Steps RNA Polymerase binds to the promoter (specific place for polymerase to bind) on the DNA and begins transcription DNA strands separate or unzip. One of the original strands serves as a template. RNA polymerase binds new RNA nucleotides to the template strand following base pairing rules. (A-U, C-G) mRNA leaves the nucleus and carries the instructions to the ribosomes. The DNA “re-zips”. A – T C – G G – C A – T C – G T – A A - - T C - - G G - - C A - - T C - - G T - - A A - U - T C - G - G G - C - C A - U - T C - G - G T - A - A A – T U C – G G G – C C A – T U C – G G T – A A 1 2 3 - 4 5

Explain and model the overall process of protein synthesis (transcription and translation). Apply knowledge of translation to predict a tRNA sequence given information about an mRNA sequence. Apply knowledge of translation to predict an amino acid sequence given information about a tRNA sequence.

How do you convert from one language to another? RNA to protein But… building blocks are mismatched. RNA “language” = 4 bases. Protein “language” = 20 amino acids. How do you convert from one language to another? mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa

But there’s still the 4 to 20 problem… TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

Solution: mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codons AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon block of 3 mRNA nucleotides that “codes” for one amino acid

Now, how are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

mRNA to protein = Translation The message -> mRNA The reader  ribosome The transporter  transfer RNA (tRNA) The product -> polypeptide/protein ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A U G G aa tRNA U A C aa tRNA G A aa tRNA C tRNA aa A G U aa aa

Transfer RNA Transfer RNA (tRNA) A folded RNA chain, with three exposed bases (anticodon) and an amino acid Which amino acid it carries depends solely on the anticodon Function: Carry amino acids to ribosome, assemble them in correct order

Translation Steps Initiation: Ribosome attaches to the mRNA at the start codon (AUG) tRNA with the complementary anti-codon (UAC) binds to the mRNA codon, bringing the amino acid methionine with it. Ribosome shifts down the mRNA to the next codon. Elongation: Another tRNA with the complementary anti-codon binds to the mRNA codon. The amino acid from the tRNA binds to methionine. The ribosome shifts again, another tRNA brings another amino acid to bind to the growing amino acid chain. Termination: Process continues until the ribosome reads a stop codon, at which time it releases the finished amino acid chain (AKA: protein)

In Animated Format http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html http://learn.genetics.utah.edu/content/begin/dna/transcribe/ http://www.dnatube.com/video/5934/Basic-explanation-of-mRNA-Translation http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__protein_synthesis__quiz_3_.html

Genetic Code All life on Earth uses the same code Code is redundant Due to common origin Code is redundant several codons for each amino acid “mutation insurance!” Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

The Genetic Code A map of CODONS, not ANTIcodons

Recap of Protein Synthesis A gene = a region of the chromosome that codes for one protein mRNA is made in the nucleus using DNA as a template. (TRANSCRIPTION) mRNA travels to ribosome. Protein is made at the ribosome by matching tRNA to mRNA. (TRANSLATION) Amino acid sequence determines protein’s shape, protein shape determines its function.

transcription translation “Central Dogma” of Molecular Genetics DNA -> RNA -> Protein -> Trait Expanded version: DNA -> mRNA -> tRNA -> amino acid sequence -> protein shape -> protein function -> trait

Mutations

Distinguish between point/substitution and frameshift/insertion/deletion mutations, and predict their effects on an amino acid sequence.

Mutations Mutations are changes in DNA sequences, usually as errors in replication different DNA order = different RNA order = different protein = different trait Human germ cell line averages 35 mutations per generation BB Bb bb

Mutations Point or Substitution mutations single base change Ex: T instead of C Can be: silent mutation no amino acid change due to redundancy in code missense change amino acid nonsense change to stop codon

Example: Sickle cell anemia

Sickle cell anemia Autosomal codominant/recessive inheritance pattern Strikes 1 in 3 Subsaharan Africans, 1 in 500 African Americans Sickle-shaped red blood cells carry less oxygen, easily “clog” blood vessels

Mutations Frameshift shift in the reading frame insertions deletions changes everything “downstream” Tends to have more profound effects than point mutations insertions adding base(s) deletions losing base(s)

Frameshift mutations (Point) THE RAT AND THE CAT ATE THE RED BAT THE RTA NDT HEC ATA TET HER EDB AT THE RAA TAN DTH ECA TAT ETH ERE DBA T (Point) THE RQT AND THE CAT ATE THE RED BAT

Example: Cystic fibrosis Primarily Northern and Western European descent strikes 1 in 2500 births 1 in 25 white Europeans are carriers (Aa) normal allele codes for a membrane protein mutant channel limits movement of Cl- (& H2O) across cell membrane thicker & stickier mucus coats cells in lungs, pancreas, digestive tract without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

Mutations Mutation = not necessarily bad. As a phenomenon, is essential to genetic diversity. And individual mutations… can be beneficial (ex: a fur color protein that more closely matches environment) can be neutral (ex: silent mutations) can be detrimental (ex: cystic fibrosis) can be beneficial and detrimental! (ex: sickle cell anemia protects against malaria)