CH 12

Starting……… Getting there……. Got IT!! I can analyze the molecular basis of heredity by explaining DNA replication, protein synthesis and gene regulation.

Remember Nucleic Acids store genetic information Building blocks = nucleotides Examples = DNA and RNA Phosphate group 5 carbon sugar base

Deoxyribonucleic Acid DNA is the code for proteins which determines traits DNA  Protein  Trait Stored in the nucleus Must be copied to be passed on to new cells Double Helix shape

Components of nucleotides Phosphate Group 5 Carbon Deoxyribose Sugar 4 Bases Purines Adenine Guanine Pyrimidines Thymine Cytosine Phosphate group Deoxyribose sugar (5 carbon) base

Sugar and Phosphate make the “backbone” of the DNA double helix Base Pairs in center of helix A = T C = G Chargoff’s rule The %A = %T and %C = %G

Which of the following does NOT describe the structure of DNA? A. double helix B. nucleotide polymer C. sugar-phosphate backbone D. contains adenine-uracil pairs E. double stranded

Which of the following does NOT describe the structure of DNA? A. double helix B. nucleotide polymer C. sugar-phosphate backbone D. contains adenine-uracil pairs E. double stranded

DNA structure discovery Watson/Crick/Franklin- 1953 They discovered the structure of DNA and how it could replicate

DNA in the cell NO NUCLEUS DNA located in cytoplasm Prokaryotes NO NUCLEUS DNA located in cytoplasm 1 large circular piece of DNA = chromosome Small circular pieces of DNA = plasmids

DNA in the cell Eukaryotes Long strands of DNA located in nucleus = chromosomes DNA tightly coiled around proteins # of chromosomes vary for different species Humans = 46 chromosomes

Remember The mitochondria and chloroplast have their own DNA separate from the nuclear DNA in eukaryotic cells Mitochondria DNA inherited from mother In mammals Has been used to

A scientist analyzed several DNA samples to determine the relative proportions of purine and pyrimidine bases. Her data shows 35% adenine bases. What would be the expected % of cytosine? A. 35% B. 30% C. 15% D. 70%

A scientist analyzed several DNA samples to determine the relative proportions of purine and pyrimidine bases. Her data shows 35% adenine bases. What would be the expected % of cytosine? A. 35% B. 30% C. 15% D. 70% Remember %A = %T and %C=%G and all percents must add to 100%. (%A+ %T) + (%C + %G) = 100% (35% + 35%) + (%C +%G) = 100% 70% + (%C + %G) = 100% %C + %G = 30% 15% (C)+ 15%(G) = 30%

Ribonucleic Acid RNA is generally a copy of a DNA gene DNA RNA  Protein  Trait Made in the nucleus but can move throughout the cell 3 types of RNA

mRNA rRNA tRNA Messenger RNA Ribosomal RNA Transfer RNA Copies of genes from DNA Make up ribosomes Transfer amino acids to ribosomes

Components of nucleotides Phosphate Group 5 Carbon Ribose Sugar 4 Bases Purines Adenine Guanine Pyrimidines Uracil Cytosine Phosphate group Ribose sugar (5 carbon) base

DNA RNA Bases Sugar Shape Location Types

In which of the following ways does RNA differ from DNA? A. RNA contains uracil and deoxyribose. B. RNA contains ribose and thymine. C. RNA contains uracil and ribose. D. RNA contains adenine and ribose. E. RNA contains uracil, thymine, and ribose.

In which of the following ways does RNA differ from DNA? A. RNA contains uracil and deoxyribose. B. RNA contains ribose and thymine. C. RNA contains uracil and ribose. D. RNA contains adenine and ribose. E. RNA contains uracil, thymine, and ribose.

12-2 DNA Replication During DNA replication, the DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing. Each strand of the double helix of DNA serves as a template, or model, for the new strand.

1. DNA bases separate by enzyme helicase 2. Enzyme DNA polymerase adds new bases to old strand 3. Proofreading by DNA polymerase Each new piece of DNA has a new strand and an old strand = semiconservative replication Is identical in base pair sequences

Replication DNA Replication: make an identical strand of DNA location? ______________________________ _________________________________________ TACGATGCGTCGTCCCCCTGTAACATT  ______________________________ Enzymes: 

12-3: Protein Synthesis DNA RNA  Protein  Trait Genes are sections of DNA that code for a protein

DNA RNA  Protein  Trait

Transcription DNA mRNA 1. RNA polymerase binds to DNA and separates the DNA strands. 2. RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA Promoters are regions of DNA that enzymes bind to which starts transcriptions

Transcription: make a single strand of mRNA location?   DNA: TACGATGCGTCGTCCCCCTGTAACATT mRNA:_______________________________ enzyme:

Translation mRNA  Protein During translation, the cell uses information from messenger RNA to produce proteins. tRNA rRNA

Translation: make a polypeptide from mRNA location? mRNA: _____________________________________   circle the codons above Name the amino acids: _____ _____ _____ _____ _____ _____ _____

Codon- 3 base sequences of mRNA that codes for an amino acid Ex) AAAGGGCCC

Which of the following nucleotide(s) bond(s) with adenine? A. thymine only B. uracil only C. cytosine and guanine D. thymine and uracil E. thymine, uracil, and cytosine

Which of the following nucleotide(s) bond(s) with adenine? A. thymine only B. uracil only C. cytosine and guanine D. thymine and uracil E. thymine, uracil, and cytosine

Make corrections… DNA: TAC CCC GAC ATA CTT AAG mRNA: AUG GCG CUG UAA GAA UUU AA: Met Ala Leu Tyr Asp Phe

Review Replication Transcription Translation Starts with Ends with Base Pairs Location

Mutations A change in the genetic code Caused by: A mistake in DNA replication ATTCGGC  ATCCGGC Carcinogens- chemicals that cause DNA mutations UV (ultaviolet) light Nuclear radiation

Kinds of mutations point mutations- change in one nucleotide substitution- switch one nucleotide with another DNA: GCATGC mutation: CCATGC Insertion/Addition- add a nucleotide mutation: GCAATGC Deletion- remove a nucleotide mutation: GCAGC chromosome mutations- change in number or structure of chromosome or chromosomes inversion, deletion polyploidy

Significance of Mutations Remember!! DNA  Protein  Trait most mutations have little or no affect on organism ex) point mutations If mutation is for same amino acid there is no change in the protein some mutations harmful ex) substitution, Sickle Cell hemoglobin: GGGCTTCTTTTT Sickle hemoglobin: GGGCATCTTTTT ex) addition/deletion are frameshift mutations- change codons = change protein ex) deletion, CF ex) addition, Huntington's 

Catalyst: Vocab Matching ___ Gene ___ Semi-conservative ___ A, T, G, C ___ A, U, G, C ___ DNA Replication ___ Transcription ___ Translation ___ Nucleotide ___ Deoxyribose ___ Ribose ___ tRNA ___ mRNA ___ rRNA Produces mRNA from a gene in DNA Bases found in RNA nucleotides Section of DNA that codes for a protein Makes up ribosomes Sugar found in DNA nucleotides Sugar, base and phosphate Transfers amino acids to ribosomes during protein synthesis Produces an identical strand of DNA Produces protein from mRNA in the ribosome Bases found in DNA nucleotides Carries instructions for the assembly of amino acids Sugar found in RNA nucleotides Replication that results in two DNA molecules with one new strand and one original strand

Review Protein Synthesis Summarize OR diagram the process

12-4: Gene Regulation

Aliens…

Who figured genetics out? Gregory Mendel Watson/Crick/Franklin- 1953 There is a hereditary chemical organisms pass on to their offspring the structure of DNA and how it could replicate