A.O. Kolo, K. Sibeko-Matjila, D. Knobel & P.T. Matjila Molecular detection of haemoparasites in dogs in Mnisi Mpumalanga Province, South Africa A.O. Kolo, K. Sibeko-Matjila, D. Knobel & P.T. Matjila

List of Contents Introduction Objectives of the Study Materials and Methods Results Discussion/Conclusion Acknowledgment

Introduction Canine vector-borne diseases have a worldwide distribution and are increasingly significant as emerging diseases Transmitted by ticks, fleas, sand flies and mosquitoes

Common haemoparasites of dogs Distribution Insect vector Diagnosis Control Babesia canis Europe Dermacentor Microscopy, serological tests ( IFAT, ELISA), Molecular diagnostics using PCR Vector control by use of systemic or topically applied acaricides B. vogelli Southern Europe, Tropical/ semi tropical region s of world. Dermacentor, Rhipicephalus sanguineus Microscopy, IFAT, PCR Vector control B. rossi South Africa Haemophysalis Rhipicephalus B. gibsoni Africa, Asia, Southern Europe, Middle East, USA H. longicornis Ehrlichia canis Africa, Mediterranean, USA R. sanguineus, Dermacentor Microscopy, IFAT, PCR, isolation and cultivation Vector control Theileria (unnamed) specie Rhipicephalus, Amblyomma, Haemophysalis Anaplasma platys Mediterranean countries, Middle East, Africa R. sanguineus, Dermacentor Hepatozoon canis Africa, Southern Europe, Middle East, USA R. sanguineus Microscopy, IFAT Good vector control, avoid feeding dogs with raw meat, prevent scavenging Common haemoparasites of dogs

Objective of the study Not much data is available on the haemoparasites of dogs in Mnisi Screen blood samples from domestic dogs in Mnisi area, Bushbuckridge for haemoparasites using the reverse line blot (RLB) hybridisation assay There is not much data available on the haemoparasites of dogs in Mnisi which is at the heart of a human-wildlife interface

Materials and Methods Sample collection- 141 blood samples collected from domestic dogs and stored on sterile FTA filter cards DNA extraction- DNA was extracted from FTA cards using QIAamp DNA mini kit®(Qiagen) according to manufacturer’s instructions. Eluted DNA was stored at -20°C until further analysis by PCR

Materials and Methods PCR amplification Genus Target gene Primer Primer Sequence Babesia and Theileria V4 region of 18S rRNA gene RLB-F2 RLB-R2 GACACAGGGAGGTAGTGACAAG CTAAGAATTTCACCTCTGACAGT Ehrlichia and Anaplasma V1 hypervariable region of 16S rRNA gene Ehr-F Ehr-R GGA ATT CAG AGT TGG ATC MTG GYT CAG CGG GAT CCC GAG TTT GCC GGG ACT TYT TCT

Materials and Methods 25µl Final PCR reaction volume Primers at final concentration of 20 pmol 5µl of DNA Platinum Quantitative PCR super mix-UDG® (Invitrogen) PCR grade water

Materials and Methods PCR conditions: optimized using a Touchdown PCR Initial Cycle 3 min at 37°C 10 min at 94°C 10 cycles for 20 sec at 94°C, 30 sec at 67°C, 30 sec at 72°C 40 cycles of denaturation for 30 sec at 72°C Annealing for 20 sec at 57°C Extension for 7 min at 72°C PCR conditions: optimized using a Touchdown PCR

Materials and Methods Reverse line blot hybridisation assay- was performed on PCR products according to (Gubbels et al, 1999; Matjila et al, 2004) PCR products were hybridized unto a membrane with specific oligonucleotide probes

Results Blot 3

Results Number of collected samples 141 Number of samples positive for Ehrlichia/Anaplasma genus-specific probes 70 (49.6%) Number of negative samples 51 (36.1%) Number of samples with mixed infections 14 (9.9%) Number of samples positive for Babesia genus-specific probe 1 31 (21.9%) Number of samples positive for Ehrlichia canis 23 (16.3%) Number of samples positive for Theileria/Babesia genus-specific probes 21 (14.9%) Number of samples positive for Babesia rossi Number of samples positive for Babesia vogelli 6 (4.25%) Number of samples positive for Theileria genus-specific probe 3 (2.12%) Number of samples positive for Babesia genus-specific probe 2 2 (1.4%)

Results Types of mixed infections Number of samples Theileria/Babesia, Ehrlichia/Anaplasma, Babesia probe 1, B. vogelli 4 Ehrlichia/Anaplasma, Theileria/Babesia, Babesia probe 1, B. rossi 3 Ehrlichia/Anaplasma, Theileria/Babesia, Babesia probe 1, B. rossi, E. canis 2 Ehrlichia/Anaplasma, E. canis, Babesia probe 1 1 Ehrlichia/Anaplasma, E. canis, Theileria/Babesia, Babesia probe 1 B. rossi, Ehrlichia/Anaplasma, Theileria probe Ehrlichia/Anaplasma, Theileria/Babesia Ehrlichia/Anaplasma, Babesia probe 1, Babesia probe 2

Discussion/Conclusion Ehrlichia canis is the most common haemoparasite present in dogs in Mnisi. Almost 50% of samples tested positive for the genus-specific probe of Ehrlichia/ Anaplasma. There will be a follow-up sequencing to find out if novel species or variants of existing species are detected 14 samples (9.9%) had mixed infections which could be related to the distribution of different arthropod vectors being present on the same host at a time After Ehrlichia canis is Babesia rossi and Babesia vogelli

Discussion/Conclusion This study presents an RLB assay that simultaneously detects and differentiates all major haemoparasites that are present in dogs in Mnisi, Mpumalanga Province The study provides preliminary data on the occurrence of haemoparasites of domestic dogs in Mnisi The study buttresses the importance of effective control measures to prevent the transmission of these haemoparasites to domestic dogs in Mnisi, and South Africa as a whole

Acknowledgement Dr Kgomotso Sibeko-Matjila Prof Tshepo Matjila Prof Darryn Knobel Mrs Milana Troskie Ms Ilse Vorster

THANK YOU!