The ABC’s of DNA Barry Bowman

The Central Dogma of Molecular Biology

DNA Structure

In humans our DNA is in 46 pieces, our chromosomes One complete set DNA molecules makes up a “genome.” This has 3 billion base pairs, ~25,000 genes. Over 95% of our DNA is not in genes.

The Genetic Code Three letters make a “word” (specify an amino acid) ATG means start, with the amino acid methionine TAA or TAG or TGA means stop DNA ATGCGTTGCGCTCAGTGCCACACCCTTGAGGAGGGCGGCGGCAACTAA RNA AUGCGUUGCGCUCAGUGCCACACCCUUGAGGAGGGCGGCGGCCAACUAA PROTEIN MetArgCysAlaGlnCysHisThrLeuGluGluGlyGlyGlyAsn

Ancestry can be determined by SNP analysis SNP = single nucleotide polymorphism a “snip” CGGGTTAAGCTGCGCCAATCGCGTATAGGCTAATTTTTGCTAAAGGGCGCGTGATGCAA * * * * CGGGTTATGCTGGGCTAATCGCGTATAGGCTAATTTTTGCTAAAGGGCGCGTTATGCAA These changes arise by mutations in the DNA. Most occurred thousands of years ago.

SNPs Humans are genetically >99 per cent identical: it is the 1% than make us different. Much of our genetic variation is caused by SNPs. Each of us has a unique genotype that typically differs in about three million nucleotides from every other person. SNPs occur about once every 300-1000 base pairs in the genome, and tend to remain stable. Because only about 3 to 5 percent of a person's DNA sequence codes for the production of proteins, most SNPs are found outside of "coding sequences".

Shared ancestry is indicated by shared clusters of SNPs CGGGTTAAGCTGGGCTAATCGCGTATAGGCTAATTTTTGCTAAAGGGCGCGTGATGCAA 1 2 3 4 5 Person # “haplotype” is a shared cluster of SNPs

Biologists have sequenced the DNA of thousands of people around the world

The Human Karyotype

Sally Hemings and Thomas Jefferson Analysis of the Y chromosome Jefferson’s uncle Father of Jefferson’s nephew’s From Nature, 5 November 1998 Another Hemings son

DNA tests may examine 1,000,000 Haplogroups

Mitochondrial DNA always comes from the mother

Mitochondria from the male do not enter the egg

Will DNA analysis fill in the blanks in our family tree?