Biology is the science of reverse-engineering life

Slides:



Advertisements
Similar presentations
The Secret Code. Genes Genes are known to: –Carry information from one generation to the next. –Put that information to work by determining the heritable.
Advertisements

Introduction to molecular biology. Subjects overview Investigate how cells organize their DNA within the cell nucleus, and replicate it during cell division.
A new method of finding similarity regions in DNA sequences Laurent Noé Gregory Kucherov LORIA/UHP Nancy, France LORIA/INRIA Nancy, France Corresponding.
Introduction to Bioinformatics Yana Kortsarts Bob Morris.
Recap Sometimes it is necessary to conduct Bad Science – often the product of having too much information Human Genome Project changed natural scientists.
Problem: Measured linearly, the Escherichia coli genome (4.6 Mb) would be 1,000 times longer than the E. coli cell. The human genome (3.4 Gb) would be.
© Wiley Publishing All Rights Reserved. Biological Sequences.
RNA STRUCTURE 1. Types of nucleic acid DNA – Deoxyribonucleic acid RNA – ribonucleic acid 2.
Advanced Molecular Biological Techniques. Polymerase Chain Reaction animation.
Applications of DNA technology
Manipulating DNA.
Chromosome Structure. the human genome consists of 23 pairs of chromosomes if all of the DNA was stretched out, it would measure 1.8 metres in length.
DNA Organization, Replication, & Repair. Model for the structure of the nucleosome.
DNA Technology. Overview DNA technology makes it possible to clone genes for basic research and commercial applications DNA technology is a powerful set.
DNA Structure and Protein Synthesis (also known as Gene Expression)
Structure of DNA and RNA
2.6 Structure of DNA and RNA
Chap 18 The Genetics of Viruses and Bacteria. Structure of Virus Approximately 20 nm in diameter Their genome can contain DNA or RNA. Enclosed by a.
10/16 Objective: What are the properties of carbohydrates? * Chapter 5: The Molecules of Life Do Now: What is a small molecular unit called? A chain of.
How does DNA copy itself?. The DNA molecule “unzips” as the rungs of the ladder separate and the molecule splits into two single strands. How DNA copies.
V 2.6 Structure of DNA and RNA Essential idea: The structure of DNA allows efficient storage of genetic information. There is 2m of DNA in each human cell,
Javad Jamshidi Fasa University of Medical Sciences, November 2015 Genes, Genomes and Chromatin Organization.
Third Generation Sequencing. Today Illumina – Solexa sequencing technology 454 Life sciences – 454 sequencer Applied Biosystem – SOLiD system Tomorrow.
Plasmids Small circular pieces of extra genomic DNA that can exit and enter bacterial cells.
The genome of prokaryotes and eukaryotes- nuclear and extranuclear genetic organization.
Chromosome Organization & Molecular Structure. Chromosomes & Genomes Chromosomes complexes of DNA & proteins – chromatin Viral – linear, circular; DNA.
Simple-Sequence Length Polymorphisms
Introduction to Biotechnology Transformation and more!
What is DNA? _________________________________
It all starts with a simple molecule called DNA…
Genetic Material - DNA and RNA
IN Match numbers with options
Molecular Genetics Transcription & Translation
Lesson Overview 12.3 DNA Replication.
Nucleic Acids Stores information
Microbial genetics lecture 10.
Human Genome Structure & Organization
DNA is Data and DNA is a Machine
Bio 211 d16 DNA!.
Higher Human Biology Sub topic 2a
DNA Mutation.
Example of a common SNP in dogs
Topics? Trying to find another way to remove oxalate
DNA Replication.
Relationship between Genotype and Phenotype
Relationship between Genotype and Phenotype
PROTEINS Polymers (long chains) of AMINO ACIDS
The Role of Enzymes DNA replication is carried out by a series of enzymes. They first “unzip” a molecule of DNA by breaking the hydrogen bonds between.
Recombinant DNA and Biotechnology
DNA Mutation.
Technology Experimental Design Cost Estimation
DNA and RNA Structure and Function
The Blue Print of Life.
THE NUCLEIC ACIDS. STRUCTURE
KEY CONCEPT DNA replication copies the genetic information of a cell.
DNA.
BSC1010: Intro to Biology I K. Maltz Chapter 21.
Unit 1: 1.1 Structure of DNA Organisation of DNA
Polymerase Chain Reaction (PCR)
DNA Interlude.
2/26 Objective: Explain the structure and function of DNA and the process of Replication. DMA: Read the O.J. Simpson- A Mountain of Evidence article.
Biology 1-2a Chromosome Structure.
KEY CONCEPT DNA replication copies the genetic information of a cell.
MOLECULAR GENETICS.
Relationship between Genotype and Phenotype
Segment 5 Molecular Biology Part 1a
Hormones are proteins that regulate many functions in the body, such as growth and cell differentiation. Which of the following does NOT describe a function.
Genes Determine the characteristics of individuals.
Dissemination of Antibiotic Resistance Genomes
DNA DeoxyriboNucleic Acid
Presentation transcript:

Biology is the science of reverse-engineering life Living organisms are molecular machines capable of replicating themselves The functional unit of life is the “cell” 1-100 um in diameter contains a primary information store: the genome

The Structure of a Genome Generally one or several strands of a polymer, called DNA, packaged into “chromosomes” Information is encoded as the order of the monomer sub-units (of types “A”, “C”, “G”, “T”) in the linear polymer Each cell carries the entire genome of the organism.

The Nature of DNA Linear, water-soluble, molecular data storage The polymer is actually “double-stranded”-each strand the “reverse-complement” of the the other The double strand is 2 nm in diameter Each monomer unit, “base”, added lengthens the strand by 0.34 nm

DNA Storage Density Genome length of an average bacterium is 2 megabases (Mb) Human genome 3 gigabases (Gb) Typical DNA “prep” solution contains about 25 petabytes/ml. (A ml is about 20 drops of a liquid.)

Perl and Genomics Good: Bad: Result: frequently middleware Perl is quick to write Excellent for parsing DWIM is good for the typical biologist Bad: Not as fast running Result: frequently middleware

My perl scripts 167 in my /bin Most are for either dealing with system stuff or parsing output from other programs A few are meant to directly analyze “sequence data”

Example Sequence Analysis Program ssr3.pl “ssr” is “simple sequence repeat” aka “microsatellite” E.g: >Echinomicrosat_01_B04_T7 XXXXXCAGAAGCGCTTCACAATTAAAAGCAAATCATACAAATATGATCAT CAGGCAGGCTATTTGAACACACTGTTTCGCACTGAACTCATAGTCACATT TCAGTCGTTCAGTGAGATGATTCATATGGCATAATTTGAACTGACGTTCG CTCTGACTATCGTTCAGCTCGTTGTGGGCACAATCGTTAGTCAGTTCGTT CACTCAACCACACACACACACACACACACGGAAACATCAGATTCGAGCTA AGCTCTTATTACAGCTGATCAGTAGGAGCACTGTTAGACAGTCTACTAAA TCAATATCAATTATCCCCCCCACACAACCATGGCTTCTGXXXXX

Example run of ssr3.pl >Echinomicrosat_01_B04_T7 %ssr3.pl Echinomicrosat_01_B04_T7.fasta Name Seq Len Range # of repetitions of sub unit Sub unit Echinomicrosat_01_B04_T7 344 209-228 10 of repeat "CA" ----------------------------- >Echinomicrosat_01_B04_T7 XXXXXCAGAAGCGCTTCACAATTAAAAGCAAATCATACAAATATGATCAT CAGGCAGGCTATTTGAACACACTGTTTCGCACTGAACTCATAGTCACATT TCAGTCGTTCAGTGAGATGATTCATATGGCATAATTTGAACTGACGTTCG CTCTGACTATCGTTCAGCTCGTTGTGGGCACAATCGTTAGTCAGTTCGTT CACTCAACCACACACACACACACACACACGGAAACATCAGATTCGAGCTA AGCTCTTATTACAGCTGATCAGTAGGAGCACTGTTAGACAGTCTACTAAA TCAATATCAATTATCCCCCCCACACAACCATGGCTTCTGXXXXX

ssr3.pl core routine: while ( $sequences{$x} =~ m/#Capture each ssr sub-unit within tolerance #Note "?" for lazy capture. Ensures "AC" is #the repeat unit instead of "ACAC" for example ([ACGT]{$min_repeat_unit_len,$max_repeat_unit_len}?) \1{$min_repeat_num,} /gix ) { my $repeat_unit = $1; my $start_of_ssr = $-[0]+1; my $end_of_ssr = $+[0]; my $ssr = $&; my $ssr_length = length($ssr)/length($repeat_unit);