Genes, traits, and morphs

Gene Genotype Phenotype www.pnas.org#cgi#doi#10.1073#pnas.0711034105

From gene to phenotype DNA Covered barley: Lemma and palea adhere to seed RNA Other genes Pathways Environmental signals Protein

DNA Five carbon sugar – deoxyribose Phosphate group Purines Five carbon sugar – deoxyribose Phosphate group Nitrogen-containing bases Pyrmidines http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/N/Nucleotides.html

Nucleotide + Nucleotide + Nucleotide + …… DNA: Polymerization Nucleotide + Nucleotide + Nucleotide + …… http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/N/Nucleotides.html

Transcription mRNA (substitute u for t) DNA join(1..83,284..884)

Translation mRNA (substitute u for t) Protein

Plant Gene Structure

From protein to phenotype Covered barley: Lemma and palea adhere to seed Other genes Pathways Environment signals Protein

ERF Transcription Factor Transcription factors General: Required for transcription. Regulatory: Bind to specific DNA sequences and regulate the expression of those sequences (genes). Can activate or repress. ERF = Ethylene responsive factor Xu et al. 2011. Functions and Application of the AP2/ERF Transcription Factor Family in Crop Improvement. http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1 Journal of Integrative Plant Biology Volume 53, Issue 7, pages 570-585, 7 JUL 2011 DOI: 10.1111/j.1744-7909.2011.01062.x http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1

The Nud ERF transcription factor Regulates an unknown gene (genes) involved in a pathway leading to synthesis of a lipid gum that causes the lemma and palea to adhere to the seed. Other genes (lipid biosynthesis) Environmental signals Protein Journal of Integrative Plant Biology Volume 53, Issue 7, pages 570-585, 7 JUL 2011 DOI: 10.1111/j.1744-7909.2011.01062.x http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1

Monomorphism Genetically the same, generation after generation, unless…… Phenotypically the same, generation after generation, unless……

Monomorphism to …........ Genetically the same, generation after generation, unless…… Phenotypically the same, generation after generation, unless……

Naked Eye Polymorphism Phenotypic Naked Eye Polymorphism (NEP) Journal of Integrative Plant Biology Volume 53, Issue 7, pages 570-585, 7 JUL 2011 DOI: 10.1111/j.1744-7909.2011.01062.x http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1

Polymorphisms Genotypic Addition, subtraction, or substitution of DNA sequence Journal of Integrative Plant Biology Volume 53, Issue 7, pages 570-585, 7 JUL 2011 DOI: 10.1111/j.1744-7909.2011.01062.x http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1

Polymorphisms Genotypic Types Insertion/ Deletion (InDel) Single nucleotide substitution (SNP)

Polymorphisms Genotypic Wild type Effect on phenotype Causal Mutant

Polymorphisms Genotypic Wild type Effect on phenotype Neutral Mutant

The source of polymorphisms Mutation The source of polymorphisms Naturally occurring Random Rare Usually deleterious The source of genetic variation Caused by errors in DNA replication DNA repair Naturally occurring color variant in hops. Shaun Townsend, OSU

The source of polymorphisms and deliciousness(?) Mutation The source of polymorphisms and deliciousness(?) Delicious Naturally occurring Random Rare Usually deleterious The source of genetic variation Caused by errors in DNA replication DNA repair Red Delicious Fuji

The source of polymorphisms Mutation The source of polymorphisms Induced Ionizing radiation (e.g. gamma rays) Random BUT can target specific types of changes (e.g. deletions) Rare BUT can manipulate frequency Usually deleterious A potential source of genetic variation Caused by errors in DNA replication DNA repair Gamma ray induced sexual variant in hops. Shaun Townsend, OSU

The source of polymorphisms Mutation The source of polymorphisms Induced Chemicals (e.g. ethyl methanesulfonate (EMS)) Random BUT can target specific types of changes, e.g. G:C to A:T Rare BUT can manipulate frequency (e.g. dosage) Usually deleterious A potential source of genetic variation Caused by errors in DNA replication DNA repair

The source of polymorphisms Mutation The source of polymorphisms Caused by errors in DNA replication https://evolution.berkeley.edu/evolibrary/article/evo_20

The source of polymorphisms Mutation The source of polymorphisms Caused by errors in DNA repair in response to errors during replication DNA damage by mutagens https://www.ncbi.nlm.nih.gov/books/NBK21114/#A8425

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype| An insertion/deletion event can produce a frameshift *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA - - - - - - - - - - -TAAG*** 11 bp deletion, alignment

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype Single nucleotide substitutions can have different consequences on phenotype Silent *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TTC AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp Tyr Gly Phe Lys translation Missense *** CTG GGA GAT TAT GGC TAT AAG*** alignment Leu Gly Asp Tyr Gly Tyr Lys translation Nonsense *** CTG GGA GAT TAG GGC TTT AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp STOP translation

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations

Targeted mutations result from heritable changes in DNA sequence May affect transcription, or translation, phenotype (target), or phenotypes (non-target)

The source of polymorphisms Mutation The source of polymorphisms CRISPR-Cas gene editing Target specific DNA sequences “Knock out” Change in function due to addition/deletion/change in sequence A powerful source of genetic variation

Mutation CRISPR Clustered regularly interspaced palindromic repeats The tools Target sequence Cas enzymes (CRISPR-associated nucleases; (e.g. Cas9) gRNA (Guide RNA) https://www.ncbi.nlm.nih.gov/pubmed/27252719

Mutation CRISPR A powerful source of genetic variation Parthenocarpic (seedless) tomato Parthenocarpy – production of seedless fruits without fertilization Auxin-mediated Targeted genes associated with auxin signaling High mutation rate No off-target mutations https://www.nature.com/articles/s41598-017-00501-4 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5428692/pdf/41598_2017_Article_501.pdf