V. RNA Ribonucleic acid

Intro The genes in DNA code for instructions that control the production of proteins within the cells The first step in decoding these genetic messages is to copy DNA into RNA (transcription) These RNA molecules contain coded information for making proteins. (translation)

A. The Structure of RNA RNA consists of a long chain of nucleotides. Each nucleotide is made up of 5-Carbon sugar A phosphate group A nitrogenous base

B. DNA vs. RNA There are three main differences between RNA and DNA: The sugar in RNA is ribose (instead of deoxyribose) RNA is single-stranded RNA contains uracil instead of thymine So A pairs with U in RNA

C. Types of RNA Main function of RNA molecules is protein synthesis. The assembly of amino acids into proteins is controlled by RNA.   Three main types of RNA: messenger RNA ribosomal RNA transfer RNA.

Disposable complementary copy of a gene 1. Messenger RNA (mRNA) Disposable complementary copy of a gene Contains instructions for assembly of a protein Transfers code from nucleus to ribosomes in the cytoplasm Exits through nucleopores

Makes up part of the ribosome 2. Ribosomal RNA (rRNA) Makes up part of the ribosome Reminder: Ribosomes are where proteins are made Ribosomes are made up of several dozen proteins and RNA

Transfers amino acids to the ribosome. 3. Transfer RNA (tRNA) Transfers amino acids to the ribosome. One end- holds amino acid Opposite end- Called the anticodon- can attach tRNA to mRNA

HW Write out questions! Make a Venn diagram to compare/contrast RNA and DNA. Answer in complete sentences: Describe how each type of RNA will contribute to protein synthesis. Make a Venn Diagram for #1

VI. Protein Synthesis A. Overview Transcription Translation In Nucleus DNARNA Translation In cytoplasm on ribosome RNA protein

B. Transcription RNA molecules are produced by copying part of a sequence of DNA into a sequence in RNA

Steps to Transcription: RNA polymerase binds to a beginning of a gene on a region of DNA called a promoter. A promoter is a sequence of DNA that acts as a start site. Enzymes (helicase) start to unwind the DNA double helix, separating the base pairs Using one of the strands as a template, RNA polymerase reads the bases and makes a complementary strand Continues until a stop signal is reached-Terminator RNA breaks free and can leave the nucleus

A single gene can produce several different forms of RNA. Very small changes in DNA or RNA sequences have dramatic effects in gene expression. Called mutations

Practice Transcribe the following sequences of DNA AAA GGG TTT CCC TAC CGA AAT CAT

C. TRANSLATION The decoding of an mRNA message into a polypeptide chain (protein) is known as translation. (RNA  Protein) Translation takes place on ribosomes.   Protein Synthesis

A sequence of 3 nucleotides on mRNA is called a codon. 1. CODONS A sequence of 3 nucleotides on mRNA is called a codon. Codons can code for: The start of a polypeptide chain Start codon= AUG (Methionine) One of 20 Amino acids (See chart) The end of a polypeptide chain Stop codons= UAA, UAG, UGA

DNA Code AGCGTGCCA mRNA code UCGCACGGU mRNA codon UCG-CAC-GGU write the amino acids that correspond to the codons on page 194

Answer Serine Histine Glycine

2. Anti-codon 3 nucleotides on tRNA that are complementary to a codon on mRNA tRNA is carrying the amino acid that the mRNA codon codes for (this is how the correct amino acid is put into place in the polypeptide chain)

3. Process of Translation Messenger RNA is transcribed from DNA in the nucleus and released into the cytoplasm Translation: Initiation- mRNA molecule attaches to a ribosome Elongation- Amino acids are transferred to the growing polypeptide chain Termination- A stop codon is reached, and the protein is released from the ribosome. http://www.youtube.com/watch?v=5bLEDd- PSTQ

VII. The Roles of RNA and DNA The cell uses the vital DNA master plan to prepare RNA blueprints The DNA molecule remains within the safety of the nucleus, while RNA molecules go to the protein- building sites in the cytoplasm of the ribosomes.

A. Genes and proteins Genes contain nothing more than instructions for assembling proteins. Ex: A gene that codes for an enzyme to produce pigment can control the color of a flower. Ex: Another gene produces an enzyme specialized for the production of red blood cell surface antigen (determines blood type). Proteins are microscopic tools, each specifically designed to build or operate a component of a living cell.

Exit Slip Transcribe and translate the following DNA sequence: TAC TTA GGG CAT ATT NEXT DAY REVIEW

HW 1. During transcription, in what direction do you expect the mRNA to be made? (think about 5’ and 3’ ends) 2. During translation, what would you expect to happen if a stop codon: a: is reached early? b: is never reached? 3. Transcribe and translate the following DNA sequence: TAC TTA GGG CAT ATT

Starter Use the following strand of DNA to make a protein: CGTAGTACCTCCATAAAACT ***Remember: AA chain/codons do not begin until a start codon