From DNA to Proteins Lesson 1.

Slides:



Advertisements
Similar presentations
Translation Proteins are made by joining amino acids into long chains called polypeptides (proteins). Each polypeptide contains a combination of any or.
Advertisements

RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
From DNA to Proteins Lesson 1. Lesson Objectives State the central dogma of molecular biology. Describe the structure of RNA, and identify the three main.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Lesson Overview 13.1 RNA.
RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.
Transcription and Translation
Chapter 13: RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
12-3 RNA and Protein Synthesis
RNA AND PROTEIN SYNTHESIS
RNA & Protein Synthesis
Structure of DNA DNA is made up of a long chain of nucleotides
CHAPTER 13 RNA and Protein Synthesis. Differences between DNA and RNA  Sugar = Deoxyribose  Double stranded  Bases  Cytosine  Guanine  Adenine 
8-2 DNA Structure & Replication  DNA - Carries information about heredity on it genes.  Deoxyribonucleic Acid  belongs to the class of macromolecules.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
Gene Expression DNA, RNA, and Protein Synthesis. Gene Expression Genes contain messages that determine traits. The process of expressing those genes includes.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.
 Genes are coded DNA instructions that will control the production of proteins  These messages have to change to RNA to be decoded.  RNA will give.
DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)
Chapter 13 From DNA to Proteins
RNA and Protein Synthesis
Chapter 13.1: RNA Essential Questions
CH 12.3 RNA & Protein Synthesis.
Lesson Overview 13.1 RNA.
RNA & Protein synthesis
12-3 RNA & Protein Synthesis
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
Lesson Overview 13.1 RNA.
DNA.
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA Ribonucleic Acid.
PROTEIN SYNTHESIS.
12-3 RNA and Protein Synthesis
Lesson Overview 13.1 RNA Objectives: Contrast RNA and DNA.
12-3 RNA and Protein Synthesis
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
13.2 Ribosomes and Protein Synthesis
Lesson Overview 13.1 RNA
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.
Protein Synthesis RNA.
BIOLOGY NOTES GENETICS PART 7 PAGES
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Chapter 3.3 What is DNA?.
RNA and Protein Synthesis
Genes and Protein Synthesis Review
RNA & Protein synthesis
Copyright Pearson Prentice Hall
Lesson Overview 13.1 RNA.
Lesson Overview 13.1 RNA.
Lesson Overview 13.1 RNA.
Presentation transcript:

From DNA to Proteins Lesson 1

Lesson Objectives State the central dogma of molecular biology. Describe the structure of RNA, and identify the three main types of RNA. Give an overview of transcription. Describe the genetic code. Explain how translation occurs.

Central Dogma of Biology DNA is found in chromosomes. eukaryotic cells, chromosomes always remain in the nucleus proteins are made at ribosomes in the cell How do the instructions in DNA get to the site of protein synthesis outside the nucleus? Another type of nucleic acid is responsible. RNA, or ribonucleic acid RNA is a small molecule that can squeeze through pores in the nuclear membrane

Central dogma of molecular biology RNA carries the information from DNA in the nucleus to a ribosome in the cell and then helps assemble the protein Central dogma of molecular biology DNA → RNA → Protein the phase itself was coined by Francis Crick

RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell. RNA molecules then carry out processes of making proteins.

Structure of RNA Backbone => 5-C sugar and phosphate group DNA  deoxyribose RNA  ribose Single- stranded DNA  double-stranded 4 Nitrogenous bases Adenine Uracil Cytosine Guanine Note: Change in Nitrogenous bases…What do you think Uracil pairs up with???? In essence RNA is a disposable copy segment of DNA; usually a working copy of a single gene Thus a single gene can produce 100s or 1000s of RNA molecules from the segment of DNA

Types of RNA 3 main types of RNA messenger RNA (mRNA) Carry copies of instructions for assembling amino acids into proteins Keep in mind the major job of RNA is protein synthesis (the making of proteins) What is the monomer of a protein???????? IT also controls the assembly of amino acids into proteins…

ribosomal RNA (rRNA) Proteins are assembled on ribosomes What are ribosomes made of? Several dozen proteins and ribosomal RNA

transfer RNA (tRNA) Transfers each amino acid to the ribosomes as specified by the coded message of mRNA

Recall replication makes a complementary copy of the entire DNA molecules before cells reproduce or divide What does it mean to transcribe something? Write a copy of it….DNA is transcribed to produce a molecule of RNA

Transcription RNA molecules are complementary copies of part of a nucleotide sequence in DNA that are made through the process of transcription RNA polymerase catalyzes transcription During transcription, RNA polymerase binds to DNA and separates the DNA (unzips it partially) strands. RNA polymerase then uses one strand of the DNA as a template from which nucletides are assembled into a strand of RNA.

sites known as promoters RNA polymerase binds to DNA at very specific sites known as promoters promoters have specific base sequences to start and stop transcription Where is DNA located in eukaryotes? Nucleus Where does transcription take place? Nucleus

RNA Editing Compiles the final mRNA molecule after many eukaryotic genes are transcribed Introns pieces that are removed Removed while RNA molecule still in nucleus Exons remaining portions Spliced back together to form final mRNA Where do you find rRNA molecules?? Ribosomes rRNA molecules are produced from larger RNA molecules that are cut and trimmed to their final size through the process of RNA editing. What happens to the introns? Biologists suggest they may play a role in evolution; making possible small changes in DNA sequences

The Genetic Code Proteins made by joining amino acids into long chains called polypeptides. Each polypeptide contains a combination of any or all 20 amino acids Properties of proteins determined by order in which amino acids are joined together

Reading the Genetic Code ‘Language’ of mRNA is the GENETIC CODE RNA  4 different nitrogenous bases: A, U, C, G Genetic Code is read 3 letters at a time Each ‘word’ is 3 bases long Each 3 letter ‘word’ in mRNA is known as a  codon The 4 nitrogenous bases write for 20 amino acids Codons consists of three consecutive nucleotides that specify a single amino acid that is to be added to a polypeptide

Examples of Genetic code RNA sequence UCGCAGGGU Read 3 bases at a time UCG- CAG- GGU UCG = Serine How many possible combinations (codons)? 4 bases; 3 letters each codon= 4 x 4 x 4 = 64 Handout codon wheel ….explain decode my codons above What amino acid is specified by CAU? Histidine Codon for tryptophan? UGG Codon(s) for glutamine? CAG, CAA Notice some amino acids have more than one codon Look at AUG= only Methionine or ‘start’ codon There are 3 ‘stop’ codons= UAA, UAG, UGA HANDOUT Quick LAB HANDOUT: Similarities & Differences between DNA & RNA = Homework CAG = Glutamine GGU = Glycine

Translation Ribosomes read mRNA and put together polypeptides decoding= translation Translation takes place on the ribosomes Cell uses information form messenger RNA to produce proteins; protein synthesis

Recap of Transcription/ Translation mRNA transcribed (CLICK, click) from DNA in nucleus and released to cytoplasm (CLICK, click) Translation begins when mRNA molecule in cytoplasm attaches to a ribosome (CLICK, click). As each codon moves through the ribosome, proper amino acid is brought into the ribosome and attached to the growing polypeptide chain (CLICK, click. Ribosome does not know which amino acid to match to each codon. Transfer RNA does that job; each tRNA molecule has an amino acid attached to one end (CLICK) and a region of three unpaired bases at the other end. The three bases on the tRNA molecule called anticodon & are complemetary to one of the mRNA codons. (CLICK). Ribosomes form a peptide bond between the first and second amino acids, then at the same time breaks the bond that had held the first tRNA molecule to its amino acid and releases the tRNA molecule. Ribosome then moves to 3rd codon, tRNA brings its amino acid etc. Polypeptide chain continues to grow until ribosome reaches a stop codon on mRNA molecule. Ribosome releases newly formed polypeptide and the mRNA molecule…translation is complete… new protein synthesized GO TO HIPPOCAMPUS SHOW ANIMATION….. HANDOUT: Making a protein= Homework

The Roles of RNA and DNA DNA “ master plan” RNA “blueprints” Remains in nucleus RNA “blueprints” Goes to protein-building sites in cytoplasm ribosomes

Genes and Proteins Most genes contain only instructions for assembling proteins Genes that code for enzymes can produce pigments for eye color, etc. Other enzyme-coding genes produce your red blood cell surface antigen thus determining your blood type Genes can also regulate rate of growth Many proteins are enzymes, which catalyze and regulate chemical reactions Proteins are the key to almost everything living cells can do