F igure 1. Graphical comparison of models used in the first test in this article, showing how the models are conceptually nested. Complexity of models.

Slides:

Advertisements

Similar presentations

 Aim in building a phylogenetic tree is to use a knowledge of the characters of organisms to build a tree that reflects the relationships between them.

Advertisements

CHAPTER 30 Structural Equation Modeling From: McCune, B. & J. B. Grace Analysis of Ecological Communities. MjM Software Design, Gleneden Beach,

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

From: A Regularist Approach to Mechanistic Type-Level Explanation

From: An open day in the metric space

From: On the Origin of Darwin's Finches

Figure 1. Subtypes of homology in molecular biology

From: Phylogenetic Inference via Sequential Monte Carlo

Fig. 1 Graphical representation

Fig. 3 Evolutionary game types as a function of relatedness and synergy where each plot is a different social group size. The payoffs used to generate.

Fig. 1. Genomic structure of the csd gene in A

From: Cost of Antibiotic Resistance and the Geometry of Adaptation

Figure 2. A comparison between the modern PMS spectral type-to-effective temperature conversion scales of Pecaut & Mamajek (2013, solid red line, labelled.

Fig. 2 Two-dimensional embedding result obtained using nMDS.

Fig. 3. ACE outperforms plmDCA in recovering the single variable frequencies for models describing (a) ER005, (b) LP SB, (c) PF00014, (d) HIV.

Figure 4. Sensitivity of illustrative simulated cumulative US deaths to cigarettes per day (CPD) reduction and to Excess Risk transition rates. See text.

Fig. 1. — The life cycle of S. papillosus. (A) The life cycle of S

Figure 1 The pattern reversal stimuli

Figure 3. Definition of the outside distance, Dout, as the sum of the distances from each of the two protein binding sites to their corresponding.

Fig. 9. Scatter plots of 500 inferred rates versus their simulated values with a model tree with six sequences and d = 0.1 for (a) ML and (b) EB-EXP. The.

From: More on the Best Evolutionary Rate for Phylogenetic Analysis

Figure 1. Conceptual model of well-being related to involvement in theatre. From: Theatre Involvement and Well-Being, Age Differences, and Lessons From.

Fig. 1 Overview of model components to identify if hormonal pleiotropy constrains or facilitates phenotypic responses to selection. The environment imposes.

From: Face Recognition is Shaped by the Use of Sign Language

Figure 1. Recent estimates of Neoaves phylogeny. a) The Jarvis et al

F igure 1. Current distribution of extant plethodontid salamanders

Figure 1. Academic productivity and high academic income: top earners vs. the rest of academics. The average number of ‘peer-reviewed article equivalents’

Fig. 1 Acoustic space for the method of images: (a) 2D corner; (b) 3D corner; (c) infinite or 2D wedge; (d) semi-infinite or 3D wedge. Half-space is not.

Fig. 2. DoFE for WGD retained genes of two subgenomes.

FIG. 1. Various models of rate variation across sites and lineages

From: Trust Busting: The Effect of Fraud on Investor Behavior

Figure 1 The branches of NJ phylogenies calculated from the main genomic ORFs of (A) 240 isolates of PVY and (B) 103 of the isolates that showed no significant.

Fig. 2. —The 26 models implemented in this study

Fig. 1 Combined phylogenetic and RelTime timetree based on the topology obtained from the “best” tree (Bayesian, GTR Gamma, 54 taxa mt + nuDNA alignment,

Fig. 1 Map of Europe presenting the three ringing stations (black circles, Hel: Heligoland; Chr: Christiansø; and Jur: Jurmo) and locations of the eight.

Fig. 1. Overview of the entire method for aggregated strings generation. (a) Extraction of 3-tags from the input set of deconvoluted MS/MS spectra. (b)

Figure 1. Example of phase shift angles among three different terns where one of them has been taken as a reference. From: Assessment of ELF magnetic fields.

Fig. 1. (A) Acclimated specific growth rates of Picochlorum species in media with varying salinity (10 mM–1.2 M). (B) Growth rates of P. oklahomensis and.

Adaptive Evolution of Gene Expression in Drosophila

Volume 19, Issue 5, Pages (May 2011)

From: String Generation for Testing Regular Expressions

Fig. 5. Number and density of species within 0. 5 s. d

Reading Phylogenetic Trees

Coupling Genetic and Ecological-Niche Models to Examine How Past Population Distributions Contribute to Divergence L. Lacey Knowles, Bryan C. Carstens,

Figure 3 Anatomical distribution of all implanted electrodes

Figure 1 Experimental workflow and predictive modelling

Phylogenetic comparative methods

Figure 1 (a) Predicted dispersal success of hatchling turtles as a function of the interaction between hatchling body ... Figure 1 (a) Predicted dispersal.

Morphological Phylogenetics in the Genomic Age

Figure 1. Colistin MIC distribution for the 153 colistin-resistant E

(A) The heat map shows an overview ...

Figure 1. autoMLST workflow depicting placement and de novo mode

Optimality principles in adaptive evolution.

Figure 1 A dot plot illustrating the correlation between the yearly absolute risk difference for both MACE and major ... Figure 1 A dot plot illustrating.

Fig. 1. The geographic range of D

(A–D) Distribution of age (A), mRSS (B), ...

Figure 1. Identification of three tumour molecular subtypes in CIT and TCGA cohorts. We used CIT multi-omics data ( Figure 1. Identification of.

Fig. 2. —Phylogenetic relationships and motif compositions of some representative MORC genes in plants and animals. ... Fig. 2. —Phylogenetic relationships.

Fig. 1. —OR gene tree including 2,973 genes from seven ants, honeybee, and jewel wasp. The tree was reconstructed ... Fig. 1. —OR gene tree including 2,973.

Figure 1. Illustration of aggregation functions on the local network of 1-decene. 1-decene is marked as target. ... Figure 1. Illustration of aggregation.

by Aida Gómez-Robles Science Volume 5(5):eaaw1268 May 15, 2019

Figure 2. Performance of penalized likelihood for the estimation of the variance covariance matrix and comparison with ... Figure 2. Performance of penalized.

Fig. 3. Phylogenetic relationship of the replicons of the family Burkholderiaceae. An unrooted RAxML maximum ... Fig. 3. Phylogenetic relationship of the.

Fig. 1. —GO categories enriched in gene families showing high or low omega (dN/dS) values for Pneumocystis jirovecii. ... Fig. 1. —GO categories enriched.

Fig. 1. Generic metabolic pathway and its corresponding adjacency matrices. The graph of a static network (A) is ... Fig. 1. Generic metabolic pathway.

Figure 2. Model adequacy results for the two empirical data sets, West African Ebola, and 2009 H1N1 influenza. The ... Figure 2. Model adequacy results.

Fig. 2. Genetic differentiation among populations and individuals

Fig. 3 Effects of plant species identity, plant traits, and soil properties on plant-soil feedbacks. Effects of plant species identity, plant traits, and.

Evolution of MADS Domain Organ Identity Quartets.

Bruce Rannala, Jeff P. Reeve The American Journal of Human Genetics

Presentation transcript:

F igure 1. Graphical comparison of models used in the first test in this article, showing how the models are conceptually nested. Complexity of models increases from top to bottom. For example, the “all origins arboreal” model collapses into the “clade-specific arboreal” model (because multiple independent origins are assigned to a single clade in the latter model). This then collapses into the five-microhabitat model (all arboreal origins within clades are given a single, arboreal optimum), which collapses into the single-optimum OU model when all microhabitat states are given the same optimum. From: Testing Convergence Versus History: Convergence Dominates Phenotypic Evolution for over 150 Million Years in Frogs Syst Biol. 2015;65(1):146-160. doi:10.1093/sysbio/syv073 Syst Biol | © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com

F igure 2. Principal components scores for species' morphology, plotted for PC2–4, which show the greatest amount of variation beyond general size among the 167 species ( Table 1 ). Loadings of raw variables on PC axes are indicated with their labels. Colors indicate microhabitat use of each species, while symbol shape indicates from which site the species comes. Species that do not occur in a specific assemblage (e.g., Laliostoma labrosum ) were plotted with the symbol of the geographically closest assemblage (e.g., Ranomafana, Madagascar). Inferred evolutionary optima from OU analyses are indicated by large circles. The figure illustrates how extant species are slightly offset from the optima. This is an effect of history, because most species can be envisioned as evolving from a terrestrial ancestral value (central optimum) toward the optimum for their current microhabitat. Values for extant species that are intermediate between the optimal value for their current microhabitat and the optimum for the ancestral, terrestrial microhabitat are considered to reflect insufficient time to adapt to the current microhabitat, and thus the impact of the past microhabitat on the current phenotype and the imprint of history ( Hansen 1997 ; Hansen et al. 2008 ). The torrent optimum in the upper plot has nearly the same value as the arboreal optimum and thus is almost entirely obscured by it. Photos represent examples of each ecomorph and are color-coded as such (from top to bottom): Phyllomedusa tomopterna , Platyplectrum ornatum , Babina pleuraden , Litoria tornieri , and Amolops tuberodepressus . All photos by DSM. From: Testing Convergence Versus History: Convergence Dominates Phenotypic Evolution for over 150 Million Years in Frogs Syst Biol. 2015;65(1):146-160. doi:10.1093/sysbio/syv073 Syst Biol | © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com

F igure 3. Phylogeny and microhabitat use in frogs F igure 3. Phylogeny and microhabitat use in frogs. The topology is from Pyron and Wiens (2011) and branch lengths (in millions of years) were estimated for this article using the Bayesian uncorrelated lognormal approach in BEAST ( Drummond and Rambaut 2007 ). Branch colors refer to ancestral states estimated by unordered, symmetric-rates maximum-likelihood ( Schluter et al. 1997 ) in R with the package diversitree ( FitzJohn 2012 ). Dotted branches are those whose reconstruction was ambiguous (no single state was at least 7.39 times more likely than the next most likely state; Pagel 1999 ); their colors represent the most likely state. We label the clades we used in our clade-specific analyses (Hyloidea + Myobatrachidae, Pelobatoidea, and Ranoidea are identified), while Discoglossoidea and Pipoidea are represented by the top terminal branch and second-from-top terminal branch (the species Discoglossus jeanneae and Xenopus wittei , respectively; see Fig. S1). Finally, circular node labels indicate other important clades discussed in this article: (1) Microhylidae, (2) Ranidae, (3) Rhacophoridae, (4) Mantellidae, (5) Bufonidae, (6) Hylidae, and (7) Pelodryadinae. See Online Supplementary Figure S1 for the species name associated with each tip. From: Testing Convergence Versus History: Convergence Dominates Phenotypic Evolution for over 150 Million Years in Frogs Syst Biol. 2015;65(1):146-160. doi:10.1093/sysbio/syv073 Syst Biol | © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com

F igure 4. Relationship between the time since transition into a given microhabitat and the multivariate morphological distance from that microhabitat's estimated optimum. Time is plotted on a logarithmic scale to reflect that the influence of past selective environments (e.g. microhabitat) decays exponentially over time in OU models ( Hansen 1997 ). The distance from the optimum has no units because it was calculated in principal components space (across PC2–10). Since terrestriality was estimated to be the ancestral microhabitat for all frogs in this analysis (see Results), we only include terrestrial species here that secondarily became terrestrial after spending part of their history in another microhabitat (e.g. Litoria tornieri ; Fig. 2 ; Online Supplementary Fig. S1). While there were not enough species in individual microhabitats to reach statistical significance separately, all microhabitat-specific correlations were negative except for terrestrial species (results not shown). From: Testing Convergence Versus History: Convergence Dominates Phenotypic Evolution for over 150 Million Years in Frogs Syst Biol. 2015;65(1):146-160. doi:10.1093/sysbio/syv073 Syst Biol | © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com