Genetics Unit I-Part C Transcription We’re back and we’re better then ever!

I. General Info -Process in which double-stranded DNA will be used to make a single-stranded RNA molecule called messenger RNA (mRNA) Transcription is, chemically and enzymatically, very similar to DNA replication, but there are some important differences: -RNA is made of ribonucleotides (rather than deoxyribonuleotides)

I. General Info RNA polymerase catalyzes the reaction (does not need a primer) The synthesized RNA does not remain base-paired to the template DNA strand Transcription selectively copies only certain parts of the genome and makes one to several hundred, or even thousand, copies of any given section of the genome.

I. General Info

I. General Info Catalyzed by a class of enzymes called RNA polymerases 3 different RNA pol’s in eukaryotes: -RNA pol I- makes ribosomal RNA -RNA pol II- makes mRNA -RNA pol III- makes tRNA The shape of the enzyme resembles a crab claw

Cont. -The RNA pol enzyme is made of 2 sub-units: a. Sigma factor b. Core-enzyme -Transcription is a 4 step process: a. binding of enzyme to DNA b. Initiation c. Elongation d. Termination -The sigma factor handles step a -The core enzyme handles steps b, c, d

II. Detailed Process A. Binding of enzyme - Sigma factor binds at sequence of DNA known as the promoter - Promoter is located before or “upstream” from where transcription will begin promoter upstream downstream 20-30 bases SS DNA site of initiation

Binding of Enzyme Cont. Promoter is always 20-30 bases upstream Promoter is recognized by sigma factor by a unique sequence of bases – “TATA” called a TATA box Transcription begins at the 1st A or G after base #20 from the promoter ex. TATA box 1st base transcribed ACGTATATTGCGCGCTTTTTTTAGTCCCTA

Detailed Process Cont. B. Initiation controlled by the core enzyme, the loosely bound enzyme binds more tightly as bases are added The sigma factor falls off C. Elongation The core factor adds bases in the 5' 3' direction as the double helix unwinds As elongation continues, promotion and initiation may begin again with a new enzyme This mean multiple mRNAs may be made simultaneously

Cont. D. Termination Transcription continues until a sequence rich in A bases is reached The RNA pol reacts with the A bases and falls off E. Other considerations Certain antibiotics work by stopping transcription Rifamycin- prevents initiation Actinomycin- prevents elongation

Diagram

III. Post-transcriptional Events Prokaryotes The mRNA made is polycistronic, containing the messages of several genes These genes are then cut up B. Eukaryotes - The RNA produced is termed hnRNA- at this point it is mostly junk

Eukaryotes Cont. Enzymes in the nucleus will degrade the junk to produce the sequences that will become mRNA Although it was believed euk. mRNA had junk at both ends with coding regions in the middle, it instead was found that the genes are split into coding and non-coding regions Non-coding regions (introns) are junk Coding regions are exons

Eukaryotes Cont. Introns are spliced out in the following manner: Sequences of complementary bases are found at each end –termed “splice junctions” A small RNA-protein molecule (a “snurp”) binds to the splice junction, causing a looping out and removal of the intron Enzyme called ribozymes then bind exons together Snurps and ribozymes together make up the spliceosome complex

Diagram exon intron snurp ribozyme

Cont. The piece of mRNA must now be processed further to protect it from enzymes in the cytoplasm The following will be added to the mRNA: 1) Methyl Cap -The first base is modified by adding methyl groups (-CH3) to the ribose sugar -A molecule of GTP is added

Cont. 2) Poly-A Tail -An enzyme will add 200 A bases to the 3' end of the molecule Final Product CH3 GTP 3' AAA mRNA 5'