Plant of the Day Cyperus esculentus - Cyperaceae Chufa (tigernut)

Slides:

Advertisements

Similar presentations

Fossils provide a record of evolution.

Advertisements

Plant diversification with respect to different sexual systems

Supervisor: VS 高志平 Reporter: R4 張妙而.  Mutations in nucleophosmin 1 ( NPM1 ) gene, one of the most common gene mutations (25%-30%) in AML  NPM1 mut co-occurs.

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

Whole Genome Duplications (Polyploidy) Made famous by S. Ohno, who suggested WGD can be a route to evolutionary innovation (focusing on neofunctionalization)

Duplications. Bar eye: caused by duplication Duplications: source of evolutionary novelty? ______________ Duplication is a source of new genes over evolutionary.

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Puffer fish phylogeny From Figure 1 Mulley, J and Holland,

Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.

History, protohistory and prehistory of the Arabidopsis thaliana chromosome complement Henry Yves et al 2006, in press.

Comparative genomics of the Brassicaceae Presented by: J. Erron Haggard To: HRT 221 May 19th, 2008.

The Statistical Significance of Max-gap Clusters Rose Hoberman David Sankoff Dannie Durand.

Sources of Genetic Variation

Polyploidy I. Types of polyploidy A. Autopolyploidy: more than 2 genetically identical genomes B. Allopolyploidy: combines the genomes of more than one.

Biological (genomic) information Dan Janies

Plant genomes: phenotypes evolving by new rules Todd J. Vision Department of Biology University of North Carolina at Chapel Hill.

Genetica per Scienze Naturali a.a prof S. Presciuttini Evolution of the eukaryotic nuclear genome The nuclear genome of eukaryotes is thought to.

How do species occur? Concept 24.2: Speciation can take place with or without geographic separation Speciation can occur in two ways: – Allopatric speciation.

Speciation can occur in two ways: Allopatric Speciation

Chapter 17 Large-Scale Chromosomal Changes

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Nothing in biology makes sense except in the light of evolution. – Theodosius Dobzhansky Evolution Charles Darwin in later years.

Genomics Lecture 8 By Ms. Shumaila Azam. 2 Genome Evolution “Genomes are more than instruction books for building and maintaining an organism; they also.

Yeast genome sequencing: the power of comparative genomics MEDG 505, 03/02/04, Han Hao Molecular Microbiology (2004)53(2), 381 – 389.

Evolution The Evidence. ‘Evolution’ stands for several theses: Mutability of species (i.e. species change over time) – (observed/confirmed) Natural selection.

whole-genome duplications and large segmental duplications… …seem to be a common feature in eukaryotic genome evolution …play a crucial role in the evolution.

Polyploids and domesticated species Natalia Alvarez UW Madison March 20 th, 2007.

1 Genome Evolution Chapter Introduction Genomes contain the raw material for evolution; Comparing whole genomes enhances – Our ability to understand.

Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.

Chapt.: 21- The Species Concept “Species and Their Formation” How does one species arise from another? Is a new species always better adapted to.

Plant of the Day Cyperus esculentus - Cyperaceae Chufa (tigernut) 8,000 kg/ha, 720 kcal/sq m per month Top Crop for kcal productivity! One of the world’s.

The plant of the day Musa acuminata (Musa balbisiana) >1000 species of bananas 4 th most important crop in developing countries Domesticated in SE Asia.

Evolutionary Significance Of Polyploidy In The New Zealand Flora

Significance Tests for Max-Gap Gene Clusters Rose Hoberman joint work with Dannie Durand and David Sankoff.

Introduction to Phylogenetic trees Colin Dewey BMI/CS 576 Fall 2015.

Genomics of Ferns and Lycophytes. Chapter 6: Structure and evolution of fern plastid genomes Paul G. Wolf and Jessie M. Roper.

Comparative genomics of Gossypium and Arabidopsis: Unraveling the consequences of both ancient and recent polyploidy Junkang Rong, John E. Bowers, Stefan.

A B C D E F G H I J K FigS1. Supplemental Figure S1. Evolutionary relationships of Arabidopsis and tomato Aux/IAA proteins. The evolutionary history was.

Types of speciation *remember, speciation is the formation of a new species  1. sympatric  2. allopatric  1. sympatric  2. allopatric.

Evolution of Duplicated Genomes Talline Martins

Issues When Dealing with Polyploids

Polyploidy Modified from PP found at /evollect04-7.ppt.

The Origin of Species What is a Species? Modes of Speciation Origin of Evolutionary Novelty.

Supplementary Fig. 1 Supplementary Figure 1. Distributions of (A) exon and (B) intron lengths in O. sativa and A. thaliana genes. Green bars are used.

CHAPTER 24 The Origin of Species.

Genetics and Evolutionary Biology

Extra credit problem for Lecture #5

Evolution: Through the Lenses of Protein Sequence and 3D Structure

12- 4 Mutations.

Rapid genome changes after polyploid formation

Evolution of Biodiversity

Variation in individual chromosome number:

By Chunfang Zheng and David Sankoff, 2014

Volume 8, Issue 6, Pages (June 2015)

Topic 10.3 Gene pools & speciation

Bio Do Now Get out natural selection lab

Polyploidy overview Polyploidy is common in plants – not because polyploids are always bigger, better and stronger but because with polyploidy there are.

Mattew Mazowita, Lani Haque, and David Sankoff

Volume 11, Issue 3, Pages (March 2018)

Genomic Clues to the Evolutionary Success of Polyploid Plants

Polyploidy overview Polyploidy is common in plants – not because polyploids are always bigger, better and stronger but because with polyploidy there are.

DON’T WORRY!! Just a photoshop award winner…

Homoeologs: What Are They and How Do We Infer Them?

Evolutionary genetics

The Evolutionary Consequences of Polyploidy

Double the Genome, Double the Fun: Genome Duplications in Angiosperms

Gautam Dey, Tobias Meyer Cell Systems

Volume 11, Issue 3, Pages (March 2018)

Complex evolutionary trajectories of sex chromosomes across bird taxa

Presentation transcript:

Plant of the Day Cyperus esculentus - Cyperaceae Chufa (tigernut) 8,000 kg/ha, 720 kcal/sq m per month Top Crop for kcal productivity! One of the world’s worst weeds

Big Questions Is polyploidy an evolutionary dead-end? If so, why are all plants the products of multiple polyploidization events? How do polyploid genomes diploidize (i.e., what are the rules)?

Paleopolyploidy Ancient whole genome duplication No different from neopolyploidy – except that it happened a long time ago Track the historical contribution of polyploid speciation to evolution

Polyploidy = Evolutionary noise (1970)‏ W. H. Wagner, Jr. “…polyploidy has contributed little to progressive evolution” (1971)‏ G. L. Stebbins

Diploidization Obscures evidence of paleopolyploidy Return to a diploid genetic system Restoration of full bivalent pairing Gene and chromosome loss Chromosomal rearrangements Proceeds at different rates in different lineages

Rosids Eurosids 1 Eurosids 2 Rosa Malus Cucumis Phaseolus Glycine Vitis Eucalyptus Brassica Arabidopsis Thellungiella Citrus Gossypium Hevea Manihot Euphorbia Linum Populus Bruguiera Glycine Phaseolus Cucumis Malus Rosa Rosids Eurosids 1 Eurosids 2

Diploidization

Methods for Identifying Paleopolyploidy Fossils Synteny relationships of duplicated genes – conserved gene order Age estimates of duplicate genes

Cell Size Increase Consequence of genome size increase 2 X increase in cell volume 1.58 X increase in cell surface area 2n 4n

Fossil Estimates Miocene Platanus Extant Platanus

Fossil Estimates Miocene Platanus n > 7 – 9 Extant Platanus 70% angiosperms Extant Platanus

Synteny Analyses Whole Genome Sequences

Synteny Analyses Whole Genome Sequences

Duplicate Gene Age Distributions No Paleopolyploidy % of Duplicate Pairs Ks (~ Time)‏

Duplicate Gene Age Distributions Carthamus tinctorius % of Duplicate Pairs Ks (~ Time)‏

Inferring Paleopolyploidy % of Duplicate Pairs Ks (~ Time)‏

Previously Known Genome Duplications Barker et al., in prep Previously Known Genome Duplications

Newly Recognized Genome Duplications Barker et al., in prep Newly Recognized Genome Duplications

Newly Recognized Genome Duplications Li et al., 2015

Newly Recognized Genome Duplications Barker et al., in prep Newly Recognized Genome Duplications Infer 61 Independent Paleopolyploidizations 36 are newly observed All seed plants are ancient polyploids!

Half are associated with paleopolyploidy (p = 0.005) Significant increases in diversification rates in flowering plants Half are associated with paleopolyploidy (p = 0.005)

What about neo-polyploidy? Application of BISSE: binary-state speciation and extinction (likelihood method developed by Maddison et al. 2007) Polyploidy:  speciation,  extinction (I. Mayrose et al. 2011, Science) Extinction Speciation number of cases number of cases higher rate in diploids higher rate in diploids

Resolution Polyploidy is most often an evolutionary dead end, but the expanded genomic potential of those polyploids that do persist drives longer term evolutionary success.

Unanswered questions Do auto- and allopolyploids differ in their evolutionary success? What factors control the fate of duplicate genes? How long must a polyploid lineage persist before it transitions from a trajectory that favors extinction to one that favors diversification? What evolutionary genetic changes/processes underlie this transition?