DNA song http://www.youtube.com/watch?v=wdhL-T6tQco https://www.youtube.com/watch?v=d1UPf7lXeO8

CHAPTER 12 :NUCLEIC ACIDS DNA, RNA, and Protein Synthesis

DNA is a code for making proteins. DNA  RNA  Protein  Traits

Nucleic Acids- DNA and RNA Monomers are nucleotides contain C, H, O, N, and P

2 Types of Nucleic Acids DNA Deoxyribonucleic Acid RNA Ribonucleic Acid

DNA Functions 1. Genetic code 2. Replication- make copies of itself (stores code for making proteins) 2. Replication- make copies of itself (Interphase of the cell cycle)

Watson and Crick (1953) first model of DNA Described as: Double Helix (Double Stranded) like a twisted ladder

Rosalind Franklin Photographed DNA using a technique called X-ray diffraction.

DNA Nucleotides Each nucleotide consists of: 1. Phosphate group 2. Deoxyribose 3. One of four nitrogen bases - Adenine (A) Guanine (G) Cytosine (C) Thymine (T)

DNA Nitrogen Bases Purines: double ring of carbon Adenine (A) Guanine (G) Pyrimidines: single ring of carbon Thymine (T) Cytosine (C)

Base Pair Rule (COMPLEMENTARY BASE PAIRING) A bonds to T: DOUBLE Hydrogen Bond C bonds to G: TRIPLE Hydrogen Bond Triple bond Double bond

Let’s Practice Building DNA! http://learn.genetics.utah.edu/content/begin/dna/builddna/

Practice

Replicated Chromosome Parts centromere 2 chromatids

Chromosomes are many genes linked together. They coil up for cell division.

A gene is a section of DNA that codes for one protein. switch gene

DNA Replication Before cell division, cells copy (replicate) their DNA during interphase Each new DNA strand now has 1 complete original strand and 1 new strand

DNA Replication unzips (breaks H bonds) DNA at the replication fork. DNA HELICASE unzips (breaks H bonds) DNA at the replication fork.

DNA Replication Con’t New DNA nucleotides are matched and attached to each side of the DNA using DNA POLYMERASE Result: Two new DNA molecules contain one original (parent) strand and one new strand

DNA polymerase moves along strand helping bond new DNA nucleotides to the original DNA strands

Proofreading Speed of DNA replication: 3,000 nucleotides/min in human 30,000 nucleotides/min in E.coli Accuracy of DNA replication: Very precise(1 error/1,000,000,000 nt)

DNA Replication

Let’s Practice DNA Replication! http://www.ncc.gmu.edu/dna/repanim.htm http://www.wiley.com/college/pratt/0471393878/instructor/animations/dna_replication/index.html

RNA: Ribonucleic Acid Formed in the nucleus SINGLE STRANDED Creates proteins for the cell Made of RNA nucleotides: * 5 C Sugar -Ribose * Phosphate group * One of four nitrogen bases: A,G, C, U (Uracil)

RNA Bases Adenine (A) Guanine (G) Cytosine (C) Uracil (U) Thymine (T) is not found in RNA but is replaced by Uracil (U)

RNA Base Pairing DNA RNA A U C G T

3 Types of RNA * carries the “Code” for protein building 1. m-RNA: messenger RNA. * carries the “Code” for protein building from DNA to a ribosome. Ribbon shaped. 2. t-RNA: transfer RNA: 20 different t-RNA exist * special shape allows it to transport a specific amino acid to a ribosome to help build a protein 3. r-RNA: ribosomal RNA. Makes up a ribosome.

Protein Synthesis Overview STEPS- 1. TRANSCRIPTION- code from DNA is copied onto RNA 2. TRANSLATION- AMINO ACIDS are linked together to make protein using RNA.

Transcription – Makes mRNA In the NUCLEUS RNA POLYMERASE: 1. Unzips the DNA 2. Reads the DNA and attaches RNA nucleotides that complement the DNA bases (Only one side of DNA will be used as a template) * Result: RNA (mRNA) breaks off from DNA and goes to the cytoplasm 3) Reattaches the two DNA strands.

Shape of m-RNA 1. Ribbon-like 2. Codons: 3 consecutive nucleotides.

Transcription http://www.youtube.com/watch?v=YxLdBNAxqKg

Overview of Translation mRNA is ‘read’ by the ribosome using codons (3 nucleotides in a row) Transfer RNA (tRNA) anticodon matches up with the m-RNA codon to create a protein

Translation – the making of a protein mRNA attaches to a ribosome (made of rRNA and protein) Each m-RNA codon will code for an amino acid Order of the amino acids determine the protein which is formed

Amino acids are determined by the order of the letters in the codon There are 64 possible 3-letter combinations These code for 20 different amino acids (each amino acid has several 3-letter combinations which can code for it)

http://www.youtube.com/watch?v=d1UPf7lXeO8

Ribosomes: Site of P.S. t-RNA brings the correct amino acid to the ribosome by matching its anticodon to mRNA’s codon Amino acids bond together by a peptide bond to make a protein

CODON TABLE

Shape of t-RNA Amino Acid Anticodons are 3 consecutive nucleotides that complement m-RNA’s codons.

Beginning of Translation

Translation

Termination of Translation

Termination of Translation

DNA transcription mRNA translation Protein

(Amino acid)

Warm-up Use the following DNA and determine the m-RNA codon and the t-RNA codon sequences. TACGGGCAGCGCTTTAAAATTGCCG List the first step of protein synthesis. Identify where in the cell it happens and what the final product is. List the second step of protein synthesis. Identify where in the cell it happens and what the final product is.

Protein Shape The expression of a trait: gene  protein trait Amino Acid Sequence determines the SHAPE and FUNCTION of a protein. The expression of a trait: gene  protein trait

Let’s Practice Protein Synthesis! http://learn.genetics.utah.edu/content/begin/dna/transcribe/