Python

What is Biopython? Biopython is a python library of resources for developers of Python-base software for bioinformatics and research. can parse bioinformatics files into local data structures Fasta, GenBank, Blast output Clustalw etc. Can access many files directly ( web database, NCBI) from within the script. Works with sequences and records Many search algorithms, comparative algorithms and format options.

Installing BioPython Comes with Anaconda. You don’t even have to type in the import commands! If you use the standard IDLE environment you will need to download BioPython and place it in the proper directory. Bioinformatics has become so important in recent years that almost every programming environment, C++, Perl, etc has its own Bioinfo libraries.

Sequence objects Biological sequences represent the main point of interest in Bioinformatics processing. Python includes a special datatype called a Sequence. Sequence objects are not the same as Python strings. They are really strings together with additional information, such as an alphabet, and a variety of methods such as translate(), reverse_complement() and so on. dna = ‘AGTACACTGGT ‘  this is a pure string // Here is how you create a sequence object. seqdna = Seq(‘AGTACACTGGT ‘, Alphabet())  sequence obj Note that seqdna is a sequence object not just a string.

Alphabets - See IUPAC (international union of pure and applied chemistry) Alphabets are just the set of allowable characters that are used in the string. IUPAC.unambiguous_dna is really just the set {A,C,G, T} of nucleotides. IUPAC.unambiguous_rna is {A,C,G,U} IUPAC.protein is just the 20 standard amino acids {A,R,N,D,C,Q,E,H,I,L,K,M,F,P,S,T,W,Y,V} and others We will use mainly the {A,C,G,T} DNA set. Nice for type checking our sequences.

Dumping Alphabets from Bio.Alphabet import IUPAC print IUPAC.unambiguous_dna.letters print IUPAC.ambiguous_dna.letters print IUPAC.unambiguous_rna.letters print IUPAC.protein.letters OUTPUT GATC GATCRYWSMKHBVDN GAUC ACDEFGHIKLMNPQRSTVWY

Can work with Sequence objects like strings from Bio.Seq import Seq from Bio.Alphabet import IUPAC my_seq = Seq("GATCG", IUPAC.unambiguous_dna) print my_seq[0]  prints first letter print len(my_seq)  print length of string in sequence print Seq(“AAAA”).count(“AA”)  non overlapping count ie 2 print GC(my_seq)  Gives the GC % of the sequence. print my_seq[2:5]  We can even slice them. Returns a Seq. #convert seq obj to a pure string obj dna_string = str(my_seq)

MutaableSeq >>>from Bio.Seq import Seq >>>from Bio.Alphabet import IUPAC my_seq = Seq("GCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA", IUPAC.unambiguous_dna) Observe what happens if you try to edit the sequence: >>> my_seq[5] = "G" Traceback (most recent call last): ... TypeError: ’Seq’ object does not support item assignment However, you can convert it into a mutable sequence (a MutableSeq object) and do pretty much anything you want with it: >>> mutable_seq = my_seq.tomutable() >>> mutable_seq MutableSeq(’GCCATTGTAATGGGCCGCTGAAAGGGTGCCCGA’, IUPACUnambiguousDNA())

We can modify these >>> mutable_seq MutableSeq(’GCCATTGTAATGGGCCGCTGAAAGGGTGCCC’, IUPACUnambiguousDNA()) >>> mutable_seq[5] = "C" >>> mutable_seq MutableSeq(’GCCATCGTAATGGGCCGCTGAAAGGGTGCCC’, IUPACUnambiguousDNA()) >>> mutable_seq.remove("T") >>> mutable_seq MutableSeq(’GCCACGTAATGGGCCGCTGAAAGGGTGCCC’, IUPACUnambiguousDNA()) >>> mutable_seq.reverse() >>> mutable_seq MutableSeq(’CCCGTGGGAAAGTCGCCGGGTAATGCACCG’, IUPACUnambiguousDNA())

Nucleotide sequences and (reverse) complements >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> my_seq = Seq("GATCGATGGGCCTATATAGGATCGAAAATCGC", IUPAC.unambiguous_dna) >>> my_seq Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA()) >>> my_seq.complement() Seq('CTAGCTACCCGGATATATCCTAGCTTTTAGCG', IUPACUnambiguousDNA()) >>> my_seq.reverse_complement() Seq('GCGATTTTCGATCCTATATAGGCCCATCGATC', IUPACUnambiguousDNA())

Reversing a Sequence an easy way to just reverse a Seq object (or a Python string) is slice it with -1 step # FORWARD >>> my_seq Seq('GATCGATGGGCCTATATAGGATCGAAAATCGC', IUPACUnambiguousDNA()) #BACKWARD ( Using a -1 step slice ) >>> my_seq[::-1] Seq('CGCTAAAAGCTAGGATATATCCGGGTAGCTAG', IUPACUnambiguousDNA())

Double Stranded DNA 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’ DNA coding strand (aka Crick strand, strand +1) 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’ ||||||||||||||||||||||||||||||||||||||| 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’ DNA template strand (aka Watson strand, strand −1)

Transcription 5’ ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG 3’ ||||||||||||||||||||||||||||||||||||||| 3’ TACCGGTAACATTACCCGGCGACTTTCCCACGGGCTATC 5’ Transcription 5’ AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG 3’ Single stranded messenger RNA

Lets do some Reverse Comp from Bio.Seq import Seq from Bio.Alphabet import IUPAC coding_dna = Seq(“ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", IUPAC.unambiguous_dna) template_dna= coding_dna.reverse_complement() print template_dna CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT

Transcribe ( T->U ) from Bio.Seq import Seq from Bio.Alphabet import IUPAC coding_dna = Seq(“ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", IUPAC.unambiguous_dna) messenger_rna = coding_dna.transcribe() print messenger_rna AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG //or you can do both messenger_rna = coding_dna.reverse_complement().transcribe()

Translate into protein from Bio.Seq import Seq from Bio.Alphabet import IUPAC messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCG AUAG", IUPAC.unambiguous_rna) print messenger_rna print messenger_rna.translate() # I added the spaces AUG GCC AUU GUA AUG GGC CGC UGA AAG GGU GCC CGA UAG MAIVMGR*KGAR* # the * represents stop codons.

Standard Translation Table

Printing Tables from Bio.Seq import Seq from Bio.Alphabet import IUPAC from Bio.Data import CodonTable stdTable = CodonTable.unambiguous_dna_by_id[1] print stdTable mitoTable = CodonTable.unambiguous_dna_by_id[2] print mitoTable

Table 1 Standard, SGC0 | T | C | A | G | --+---------+---------+---------+---------+-- T | TTT F | TCT S | TAT Y | TGT C | T T | TTC F | TCC S | TAC Y | TGC C | C T | TTA L | TCA S | TAA Stop| TGA Stop| A T | TTG L(s)| TCG S | TAG Stop| TGG W | G C | CTT L | CCT P | CAT H | CGT R | T C | CTC L | CCC P | CAC H | CGC R | C C | CTA L | CCA P | CAA Q | CGA R | A C | CTG L(s)| CCG P | CAG Q | CGG R | G A | ATT I | ACT T | AAT N | AGT S | T A | ATC I | ACC T | AAC N | AGC S | C A | ATA I | ACA T | AAA K | AGA R | A A | ATG M(s)| ACG T | AAG K | AGG R | G G | GTT V | GCT A | GAT D | GGT G | T G | GTC V | GCC A | GAC D | GGC G | C G | GTA V | GCA A | GAA E | GGA G | A G | GTG V | GCG A | GAG E | GGG G | G Table 2 Vertebrate Mitochondrial, SGC1 | T | C | A | G | --+---------+---------+---------+---------+-- T | TTT F | TCT S | TAT Y | TGT C | T T | TTC F | TCC S | TAC Y | TGC C | C T | TTA L | TCA S | TAA Stop| TGA W | A T | TTG L | TCG S | TAG Stop| TGG W | G C | CTT L | CCT P | CAT H | CGT R | T C | CTC L | CCC P | CAC H | CGC R | C C | CTA L | CCA P | CAA Q | CGA R | A C | CTG L | CCG P | CAG Q | CGG R | G A | ATT I(s)| ACT T | AAT N | AGT S | T A | ATC I(s)| ACC T | AAC N | AGC S | C A | ATA M(s)| ACA T | AAA K | AGA Stop| A A | ATG M(s)| ACG T | AAG K | AGG Stop| G G | GTT V | GCT A | GAT D | GGT G | T G | GTC V | GCC A | GAC D | GGC G | C G | GTA V | GCA A | GAA E | GGA G | A G | GTG V(s)| GCG A | GAG E | GGG G | G

Codon - Amino Acids Amino Acid SLC DNA codons Isoleucine I ATT, ATC, ATA Leucine   L CTT, CTC, CTA, CTG, TTA, TTG Valine V GTT, GTC, GTA, GTG Phenylalanine   F TTT, TTC Methionine M ATG Cysteine  C TGT, TGC Alanine       A GCT, GCC, GCA, GCG Glycine   G GGT, GGC, GGA, GGG Proline       P CCT, CCC, CCA, CCG Threonine   T ACT, ACC, ACA, ACG Serine        S TCT, TCC, TCA, TCG, AGT, AGC Tyrosine   Y TAT, TAC Tryptophan   W TGG Glutamine   Q CAA, CAG Asparagine   N AAT, AAC Histidine  H CAT, CAC Glutamic acid   E GAA, GAG Aspartic acid  D GAT, GAC Lysine        K AAA, AAG Arginine   R CGT, CGC, CGA, CGG, AGA, AGG Stop codons Stop TAA, TAG, TGA .

The SeqRecord Object A SeqRecord is a structure that allows the storage of additional information with a sequence. This includes the usual information found in standard genbank files. The following is a sample of the fields in SeqRecord. .seq - The sequence .id - The primary ID used to identify the sequence (String) .name – The common name of the sequence .annotations – A dictionary of additional information about the sequence .features –A list of SeqFeature objects and others.

Build From Scratch >>> from Bio.Seq import Seq >>> simple_seq = Seq("GATC") >>> from Bio.SeqRecord import SeqRecord >>> simple_seq_r = SeqRecord(simple_seq) or pass in the id, description etc. >>> simple_seq_r.id = "AC12345" >>> simple_seq_r.description = "Made up sequence I wish I could write a paper about" >>> print(simple_seq_r.description) Made up sequence I wish I could write a paper about >>> simple_seq_r.seq Seq(’GATC’, Alphabet())

Fill SeqRecord from Fasta file >gi|45478711|ref|NC_005816.1| Yersinia pestis biovar Microtus ... pPCP1, complete sequence TGTAACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAA TCAGATCCAGGGGGTAATCTGCTCTCC ------------------------------------------------------------------------------------------ >>> from Bio import SeqIO # Note that SeqIO.read will only read one record. >>> record = SeqIO.read("NC_005816.fna", "fasta") >>> record SeqRecord(seq=Seq(’TGTAACGAACGGTGCAATAGTGATCCACA CCCAACGCCTGAAATCAGATCCAGG...CTG’, SingleLetterAlphabet()), id=’gi|45478711|ref|NC_005816.1|’, name=’gi|45478711|ref|NC_005816.1|’, description=’gi|45478711|ref|NC_005816.1| Yersinia pestis biovar Microtus ... sequence’, dbxrefs=[])

ACCEss the fields Individually >>> record.seq Seq(’TGTAACGAACGGTGCAATAGTGATCCACACCCAACGC CTGAAATCAGATCCAGG...CTG’, SingleLetterAlphabet()) >>> record.id ’gi|45478711|ref|NC_005816.1|’ >>> record.description ’gi|45478711|ref|NC_005816.1| Yersinia pestis biovar Microtus ... pPCP1, complete sequence’

These are missing >>> record.dbxrefs [] >>> record.annotations {} >>> record.letter_annotations {} >>> record.features [] Note which is a dict and which is a list!!

Reading Genbank Files LOCUS NC_005816 9609 bp DNA circular BCT 21-JUL-2008 DEFINITION Yersinia pestis biovar Microtus str. 91001 plasmid pPCP1, complete sequence. ACCESSION NC_005816 VERSION NC_005816.1 GI:45478711 PROJECT GenomeProject:10638

Read the File >>> from Bio import SeqIO >>> record = SeqIO.read("NC_005816.gb", "genbank") >>> record SeqRecord(seq=Seq(’TGTAACGAACGGTGCAATAGTGATCC ACACCCAACGCCTGAAATCAGATCCAGG...CTG’, IUPACAmbiguousDNA()), id=’NC_005816.1’, name=’NC_005816’, description=’Yersinia pestis biovar Microtus str. 91001 plasmid pPCP1, complete sequence.’, dbxrefs=[’Project:10638’])

Read a record from Bio import SeqIO record = SeqIO.read("micoplasmaGen.gb","genbank") print record.description ct=0 for f in record.features: if f.type=='gene': ct+=1 print ct