13.2 – Manipulating DNA.

Slides:



Advertisements
Similar presentations
15.2 Recombinant DNA.
Advertisements

13-2 Manipulating DNA.
Go to Section: which crosses consists of Selective Breeding for example Inbreeding Hybridization Similar organisms Dissimilar organisms for example Organism.
13–2Manipulating DNA A.The Tools of Molecular Biology 1.DNA Extraction Homogenization: Cell walls, membranes, and nuclear material are broken Emulsification:
1 Review Describe the process scientists use to copy DNA Use Analogies How is genetic engineering like computer programming 2 Review What is a transgenic.
 It is important to know the order of nucleotides in a strand of DNA  The process of DNA sequencing (determining the order of nucleotides) uses processes.
Interest Grabber A New Breed
Genetic Engineering and The Human Genome
G ENETIC E NGINEERING Chapter 13. C HANGING THE L IVING W ORLD 13-1.
Modern Genetics.
A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed.
Chapter 13 It is the stuff of cartoons 1. Genetic engineering is the stuff of movies. Can you name a recent movie? 2.
Genetic Engineering. Tools of Molecular Biology DNA Extraction Cutting DNA Restriction Enzymes Recognize certain sequences of DNA and cut the hydrogen.
Biotechnology. Early Biotechnology = using organisms or their cellular processes to improve the lives and health of people and the planet Has evolved.
Objective: You will be able to list the positives and negatives of genetic engineering Do Now: Read “Increasing variation” which starts on p. 320 and ends.
A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed.
 A New Breed  The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed.
Genetic Engineering Regular Biology. Selective Breeding  This is the process of allowing those organisms with specific characteristics to reproduce 
Ch. 13 Genetic Engineering
Slide 1 of 32 Copyright Pearson Prentice Hall Biology.
Copyright Pearson Prentice Hall DNA Technology. Copyright Pearson Prentice Hall Selective Breeding Selective breeding allows only those organisms with.
End Show Slide 1 of 32 Copyright Pearson Prentice Hall Manipulating DNA.
13–2Manipulating DNA A.The Tools of Molecular Biology 1.DNA Extraction Homogenization: Cell walls, membranes, and nuclear material are broken Emulsification:
Chapter 15: Genetic Engineering
Section 2 Genetics and Biotechnology DNA Technology
13-1 Changing the Living World
NIS - BIOLOGY Lecture 57 – Lecture 58 DNA Technology Ozgur Unal 1.
End Show Slide 1 of 21 Copyright Pearson Prentice Hall 13-3 Cell Transformation Recombinant DNA Host Cell DNA Target gene Modified Host Cell DNA.
Cell Transformation, Transgenic Organisms & Cloning
Chapter 13: Genetic Engineering Standard 5.c Students will know how genetic engineering (biotechnology)is used to produce novel biomedical and agriculture.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Manipulating DNA. Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules Different techniques.
Genetic Engineering How do scientists make changes to DNA?
13.2 – Manipulating DNA. The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters,
End Show Slide 1 of 32 Copyright Pearson Prentice Hall Biology.
KEY CONCEPT DNA sequences of organisms can be changed.
9.1 Manipulating DNA KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
DNA technology and Genetic Engineering Genetic engineering: Process of making changes in an organism’s DNA –Different than selective breeding….. –We physically.
15.2 Recombinant DNA. Copying DNA – How do scientists copy the DNA of living organisms? –The first step in using the polymerase chain reaction method.
Genetic Engineering Biotechnology
Biotechnology.
V Cell Transformation Recombinant DNA Host Cell DNA Target gene
Chapter 13 Frontiers of Genetics.
Copyright Pearson Prentice Hall
Section 2 Genetics and Biotechnology DNA Technology
Chapter 13.2 Manipulating DNA.
The practical use and application of biology.
Scientists use several techniques to manipulate DNA.
More on Genetics.
DNA Technology.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Genetic Engineering Study Guide Review.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Interest Grabber A New Breed
Genetic Engineering.
RDNA and CLONING.
Q.Q. 1/17/19 What does “genetic engineering” mean?
13-1 Changing the Living World
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Biology, 9th ed,Sylvia Mader
Genetic Engineering and Cloning
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Recombinant DNA and Genetic Engineering
Copyright Pearson Prentice Hall
Frontiers of Biotechnology
Jeopardy Final Jeopardy Topic 1 Topic 2 Topic 3 Topic 4 Topic 5 $100
Presentation transcript:

13.2 – Manipulating DNA

Interest Grabber The Smallest Scissors in the World Section 13-2 The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

Interest Grabber continued Section 13-2 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Go to Section:

Section Outline 13–2 Manipulating DNA A. The Tools of Molecular Biology 1. DNA Extraction 2. Cutting DNA 3. Separating DNA B. Using the DNA Sequence 1. Reading the Sequence 2. Cutting and Pasting 3. Making Copies Go to Section:

The Tools of Molecular Biology Genetic engineering – making changes in the DNA code of a living organism DNA extraction – by a simple chemical procedure Cutting DNA – most DNA to large to be analyzed Can be cut precisely at restriction enzymes Separating DNA – gel electrophoresis

Gel Electrophoresis DNA plus restriction enzyme Power source Longer fragments Shorter fragments Mixture of DNA fragments Gel

Recognition sequences Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end Go to Section:

Recognition sequences Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end Go to Section:

Using the DNA Sequence After the DNA is shortened up it can now be read, studied and even changed The function of different genes can now be discovered

Reading the sequence http://www.dnai.org/b/index.html Small pieces of single-strand DNA are “tagged” with fluorescent dye Using gel-electrophoresis, the fragments are separated The pattern of the colored bands tells the exact sequence of bases in the DNA

Cutting and Pasting DNA sequences can be changed in many ways Short sequences can be “synthesized” and joined with “natural” DNA and spliced together using enzymes The same enzymes can join a gene from one organism and attach it to the DNA of another Recombinant DNA- DNA molecules produced by combining DNA from different sources

Knockout Genes Section 13-3 Recombinant DNA Host Cell DNA Target gene Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Go to Section:

Making Copies What is PCR? Sometimes called "molecular photocopying," the polymerase chain reaction (PCR) is a fast and inexpensive technique used to "amplify" - copy - small segments of DNA. Because significant amounts of a sample of DNA are necessary for molecular and genetic analyses, studies of isolated pieces of DNA are nearly impossible without PCR amplification. Often heralded as one of the most important scientific advances in molecular biology, PCR revolutionized the study of DNA to such an extent that its creator, Kary B. Mullis, was awarded the Nobel Prize for Chemistry in 1993.

What is PCR used for? Once amplified, the DNA produced by PCR can be used in many different laboratory procedures. For example, most mapping techniques in the Human Genome Project (HGP) rely on PCR. PCR is also valuable in a number of newly emerging laboratory and clinical techniques, including DNA fingerprinting, detection of bacteria or viruses (particularly AIDS), and diagnosis of genetic disorders

Figure 13-8 PCR Section 13-2 Go to Section: DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied http://www.dnai.org/b/index.html PCR cycles 1 DNA copies 1 2 3 4 4 8 5 etc. 16 etc. Go to Section:

Interest Grabber Sneaking In Section 13-3 Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Go to Section:

Interest Grabber continued Section 13-3 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Go to Section:

Section Outline 13–3 Cell Transformation A. Transforming Bacteria B. Transforming Plant Cells C. Transforming Animal Cells Go to Section:

Cell Transformation During transformation, a cell takes in DNA from outside the cell This external DNA becomes part of the cell’s DNA

Transforming Bacteria Use recombinant DNA

Figure 13-9 Making Recombinant DNA Section 13-3 Gene for human growth hormone Recombinant DNA Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid http://www.dnai.org/b/index.html Go to Section:

Plant Transformation Agrobacterium tumefaciens – Causes plant tumors.

Figure 13-10 Plant Cell Transformation Section 13-3 Tumor causing bacteria Agrobacterium tumefaciens Gene to be transferred Cellular DNA Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Recombinant plasmid Plant cell colonies Transformed bacteria introduce plasmids into plant cells Complete plant is generated from transformed cell http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120078/bio40.swf::The%20Ti%20Plasmid Go to Section:

Interest Grabber The Good With the Bad Section 13-4 The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Go to Section:

Interest Grabber continued Section 13-4 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Go to Section:

Flowchart Cloning Section 13-4 A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal. Go to Section:

Figure 13-13 Cloning of the First Mammal Section 13-4 A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell Egg Cell The nucleus of the egg cell is removed. An egg cell is taken from an adult female sheep. The fused cell begins dividing normally. Cloned Lamb Embryo The embryo develops normally into a lamb—Dolly The embryo is placed in the uterus of a foster mother. Foster Mother Go to Section: