Every living organism inherits a blueprint for life from its parents.

Slides:



Advertisements
Similar presentations
DNA Biochemical Processes and Forensic Applications. 1.
Advertisements

Meiosis Past Paper Questions.
 4.1.1: State that eukaryotic chromosomes are made of DNA and proteins  4.1.2: Define gene, allele and genome  4.1.3: Define gene mutations  4.1.4:
Structural Genomics and Human Health
Every living organism inherits a blueprint for life from its parents.
3.1 Genes Understanding: -A gene is a heritable factor that consists of a length of DNA and influences a specific characteristic -A gene occupies a specific.
Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.
TOPIC 4: GENETICS. 4.1: Chromosomes, genes, alleles and mutations ★ State that eukaryote chromosomes are made of DNA and proteins. ★ Define gene, allele.
Genes (3.1) IB Diploma Biology Essential Idea: Heritable traits are passed down to offspring through genes.
Topics 4 and 10 GENETICS Genetics is the study of how inherited information is passed on from one generation to the next using genetic material….genes.
Genetic Mutations. Mutation: An unpredictable change in the genetic material of an organism Gene Mutation: A change in the structure of a DNA molecule,
List diseases that can be caused by mutations Cystic fibrosis Sickle cell anaemia Tay-Sachs disease Phenylketonuria Colour-blindness Cancers
Chromosomes, genes, alleles, and mutation Topic 4.1.
Small Scale Mutations & Gene Expression. LARGE MUTATIONS & GENETICS Quick Review.
Gene Regulations and Mutations
Topic 4.1 Chromosomes, Genes, Alleles and Mutations.
By Chris Paine Genes Essential idea: Every living organism inherits a blueprint for life from its parents. Genes and.
13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)
Mutations Changes to DNA. What are Mutations? Any change to the DNA Mutations in body (somatic) cells can cause cell death or cancer Those in germ (sex)
Welcome to Genetic Mutations! 7x2WSY 7x2WSY.
GENETICS Dr. Samar Saleh Assiss. Lecturer Mosul Medical College Pathology3 rd year.
So Mutations!  Any change to the quantity or structure of DNA of an organism is known as a mutation.  Mutations can occur in either somatic cells (body.
MUTATIONS Slide 2MutationsMutations Slide 3Examples of MutationsExamples of Mutations Slide 4How Mutations occurHow Mutations occur Slide 5The Benefit.
Topic 3 Genetics Which of these are determined by DNA? Skin colour Freckles Number of fingers on each hand Blood type Colour blindness Sex (male/female)
Genetics 3.1 Genes. Essential Idea: Every living organism inherits a blueprint for life from its parents.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
BY: RAHUL AND COLBY. Define terms: Gene, Allele, and Genome Gene: a heritable factor that controls a specific characteristic. Allele: one specific form.
Do Now: What is a gene? A sequence of nucleotides
It’s in the genes Lesson 3.2.
Molecular mechanism of mutation
Genetics.
Genes (3.1) Essential Idea: Heritable traits are passed down to offspring through genes.
Protein Synthesis.
4.1 Chromosomes, genes, alleles and mutations
Genetics Topic3.
DNA MUTATIONS.
Mutations.
Types of Mutations.
Genes 3.1.
REVISION: GENETICS Topic 4.2 IB Biology Miss Werba.
Biology Mutations SNL Biology Copyright Pearson Prentice Hall.
CHROMOSOMES, ALLELES, GENES & MUTATIONS
PROTEIN SYNTHESIS AND MUTATIONS
Genes and Genomes.
Gene Mutations.
3.1 Genes Essential idea: Every living organism inherits a blueprint for life from its parents. Genes and hence genetic information is inherited from parents,
It’s Friday! Today’s Warm up!
Mutations.
Genes 3.1.
3.1 Genes Genes and hence genetic information is inherited from parents, but the combination of genes inherited from parents by each offspring will be.
Types of point mutations
Every living organism inherits a blueprint for life from its parents.
Mutations.
Genetics Topic3.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
3.1 Genes Genes and hence genetic information is inherited from parents, but the combination of genes inherited from parents by each offspring will be.
Welcome to Genetic Mutations!
3.1 Genes Essential idea: Every living organism inherits a blueprint for life from its parents. Genes and hence genetic information is inherited from.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
What has happened? Substitution mutation
Protein Synthesis.
1) Base Mutations 2) Chromosomal Mutations
Gene Protein Genome Proteome Genomics Proteomics.
Mutations and sickle cell anemia
Mutation Notes.
Section 20.4 Mutations and Genetic Variation
Chromosomes, genes, alleles, and mutations.
Dr. Israa ayoub alwan Lec -10-
Presentation transcript:

Every living organism inherits a blueprint for life from its parents. 3.1 Genes Every living organism inherits  a blueprint for life from its parents.

Understandings: A gene is a heritable factor that consists of a length of DNA and influences a specific characteristic A gene occupies a specific position on a chromosome The various specific forms of a gene are alleles Alleles differ from each other by one or only a few bases New alleles are formed by mutation The genome is the whole of the genetic information of an organism The entire base sequence of human genes was sequenced in the Human Genome Project Applications: The causes of sickle cell anaemia, including a base substitution mutation, a change to the base sequence of mRNA transcribed from it and a change to the sequence of a polypeptide in haemoglobin Comparison of the number of genes in humans with other species Skills: Use of a database to determine differences in the base sequence of a gene in two species

Genes and Loci DNA is the genetic blueprint which codes for, and determines, the characteristics of an organism. Gene is a sequence of DNA that encodes for a specific trait (traits may also be influenced by multiple genes) The position of a gene on a particular chromosome is called the locus. (plural – loci)

Alleles Alleles are alternative forms a gene that code for the different variations of a specific trait. For example, the gene for eye colour has alleles that encode different shades/pigments As alleles are alternative forms of the one gene, they possess very similar gene sequences. Alleles only differ from each other by one or a few bases.

Mutations A gene mutation is a change in the nucleotide sequence of a section of DNA coding for a specific trait. New alleles are formed by mutation Gene mutations can be beneficial, detrimental or neutral. Beneficial mutations change the gene sequence (missense mutation) to create new variations of a trait. Detrimental mutations shorten the gene sequence (nonsense mutations) to stop the normal function of a trait. Neutral mutations have no effect on the functioning of the specific feature (silent mutations)

Sickle Cell Anaemia Sickle cell anaemia is an example of a disorder caused by a gene mutation. The disease allele arose from a base substitution mutation – where a single base was changed in the gene sequence. Causes of Sickle Cell Anaemia Sickle cell anaemia results from a change to the 6th codon for the beta chain of haemoglobin. DNA: The DNA sequence changes from GAG to GTG on the non-coding strand (CTC to CAC on the coding strand) mRNA: The mRNA sequence changes from GAG to GUG at the 6th codon position. Polypeptide: The sixth amino acid for the beta chain of haemoglobin is changed from glutamic acid to valine (Glu to Val)

Consequence of Sickle Cell Anaemia The amino acid change (Glu  Val) alters the structure of haemoglobin, causing it to form insoluble fibrous strands. The insoluble haemoglobin cannot carry oxygen as effectively, causing the individual to fell constantly tired. The formation of fibrous haemoglobin strands changes the shape of the red blood cell to a sickle shape. The sickle cells may form clots within the capillaries, blocking blood supply to vital organs and causing myriad health issues. The sickle cells are also destroyed more rapidly than normal cells, leading to a low red blood cell count (anaemia)

Genome Genome is the total genetic information of a cell, organism or organelle This includes all genes all well as non-coding DNA sequences The human genome consists of: 46 chromosomes 3 billion base pairs 21,000 genes

Human Genome Project The entire base sequence of human genes was sequenced in the Human Genome Project. There is approximately 23,000 genes Discovered “junk DNA”