Gene Mutations.

Slides:

Advertisements

Similar presentations

Copyright © 2006 Pearson Education, Inc., publishing as Benjamin Cummings Translation  mRNA is translated in codons (three nucleotides)  Translation.

Advertisements

Chapter 17.5 Gene expression and Mutations

Gene Mutations.

DNA Mutations Biology 6(E).

Mutations are changes in genetic material

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

1 Gene – Expression – Mutation - polymorphism. 2 How are genes expressed ? Nucleus Cytoplasm DNA Transcription Poly(A ) Cap Pre-mRNA Splicing Cap Poly(A)

Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.

Definition : Any change in the nucleotide sequence of DNA.

Ch Mutations Section Objectives:

Biology 12. WHAT ARE MUTATIONS?  Changes in the nucleotide sequence of DNA  May occur in somatic cells (aren’t passed to offspring)  May occur in.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Gene Mutations. O A mutation is a permanent change in the DNA sequence of a gene. O Any change in this sequence is likely to change the message transcribed.

Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

Point Mutations Silent Missense Nonsense Frameshift.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Genetics. Mutations of Genes Mutation – change in the nucleotide base sequence of a genome; rare Not all mutations change the phenotype Two classes of.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

Chapter 10 Mutations Student Mutations can change the meaning of genes  A mutation is any change in the nucleotide sequence of DNA.  Mutations.

 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

The Cell Cycle.

12.4 Assessment Answers.

DNA/GENE MUTATIONS.

Wild-type hemoglobin DNA Mutant hemoglobin DNA LE Wild-type hemoglobin DNA Mutant hemoglobin DNA 3¢ 5¢ 3¢ 5¢ mRNA mRNA 5¢ 3¢ 5¢ 3¢ Normal hemoglobin.

“How does it affect the protein?”

Gene Mutations.

Mutation In Bacteria Dr.Gulve R.M.

Types of Mutations.

Microbial Genetics - DNA Transfer

DNA and mutations SC.912.L.16.4.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Genetic Mutations.

Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.

Gene – Expression – Mutation - polymorphism

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations changes in the DNA sequence that can be inherited

Entry Task Apply: Suppose a template strand of DNA had the following wild-type gene sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

What can you infer from this cartoon?

Mutations Section 12-4.

Distinguish between codon and anticodon.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutation: Some Definitions

Mutation Notes.

Section 20.4 Mutations and Genetic Variation

Protein Synthesis and Mutation

Mutations: Changes in Genes

Gene Mutations.

Presentation transcript:

Gene Mutations

What is a mutation? Mutation: a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene. Point mutation: single nucleotide base changes in a gene's DNA sequence.

Point Mutations

Missense mutations Point mutations that result in a single amino acid change within the protein.

Nonsense mutations Point mutations that create a premature "translation stop signal" (or "stop" codon), causing the protein to be shortened.

Silent Mutations Point mutations that do not cause amino acid changes within the protein. (Recall 64 codons for 20 Amino Acids)

Insertions and Deletions Add or remove one or more DNA bases. Insertion and deletion cause frameshift mutations, which change the grouping of nucleotide bases into codons. This results in a shift of "reading frame" during protein translation.

Mutation Rate Calculated based on probability that the DNA will mutate spontaneously during a specific interval Measured as # DNA base pairs changed per unit time Spontaneous mutations = DNA replication errors Non-spontaneous mutations: Radiation: ionizing (X-Rays) & Nonionizing (UV light) Chemicals: alkylating agents (methylate DNA), and carcinogens – act as alkylating agents.

Mutation Practice Sentence Write down this DNA sequence, and then transcribe (mRNA) and translate (AA) it using the codon chart: TAC GGG GGC CTT ACC ACG ATC