46 23 Same: size, shape, genes XY XX smaller

Gene Expression Environment can affect phenotype being expressed HIMALAYAN RABBIT – temp causes activation and deactivation of fur color genes Low temp = black fur High temp = white fur

Double helix replicate A T G C A T G C A U G C

DNA REPLICATION Ability to copy code instructions in DNA Single strand is a template New subunits attach to template to create a new strand Needed for cell division and new offspring during reproduction

RNA Single strand Found in nucleus, cytoplasm, ribosome Complementary base pairing A - U G - C Sequence of bases codes for specific amino acid (codon)

3 nucleus ribosomes RNA mRNA tRNA protein shape function function

Amino bases acids shape function

PROTEIN SYNTHESIS STEP 1: nucleus = DNA codes of mRNA, enzymes needed STEP 2: cytoplasm = mRNA travels from nucleus through cytoplasm to ribosomes STEP 3: ribosomes = tRNA moves amino acides to ribosomes for assembly of proteins, amino acids bonded in order specified by mRNA TRANSCRIPTION TRANSLATION

Protein Synthesis: From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

Protein Synthesis: From gene to protein cytoplasm aa transcription translation DNA mRNA protein ribosome mRNA leaves nucleus through nuclear pores U C A G proteins synthesized by ribosomes using instructions on mRNA trait nucleus

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Tyr GCA Ala tRNA CAU His anti-codon amino acid

Let’s Review: TRANSCRIPTION DNA to RNA nucleus TRANSLATION RNA to protein ribosome

DNA mRNA tRNA or codon Amino acid

Change in chromosome/gene sequence Amino acids Something that could cause mutations Radiation, chemicals…etc

NONDISJUNCTION Addition of loss of 1 chromosome chromosomal mutation abnormal separation during ANAPHASE 1 (meiosis) Trisomy 21 – Down’s Syndrome

Mutations cause….. different folding of proteins – cause protein malfunction cells to die mutated cells survive and replicate DNA = more cells mutated in body can only be passed on to offspring if occur in sex cells Disorders caused by mutations… Sickle cell anemia Cystic fibrosis

Choose desirable trait for breeding Alter genetic instructions Restriction enzymes protein the same Bacteria Insulin Human growth

Recombinant DNA Isolated gene Plasmid Mitosis

RECOMBINANT DNA TECHNOLOGY ISOLATED GENE RESTRICTION ENZYMES PLASMID RECOMBINANT DNA

+ Sticky ends are exposed, glue genes together gene from other organism + recombinant plasmid vector Sticky ends are exposed, glue genes together plasmid transformed bacteria grow bacteria

Why Genetic Engineering?? Insulin and other human hormones Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value

DNA fragments move Largest to smallest

Isolated gene Recombinant DNA plasmid

Electric current, moving from large to small fragments different banding patterns

There is no right answer for a choice Radiation uv Rays chemicals

The diagram below represents a genetic procedure. Which statement best describes the outcome of this procedure? (1) Bacterial cells will destroy defective human genetic material. (2) Bacterial cells may form a multicellular embryo. (3) The inserted human DNA will change harmful bacteria to harmless ones. (4) The inserted human DNA may direct the synthesis of human proteins.