Figure S3 Gui99 1 2 3 4 5 6 3.9kb a TP309 1 2 3 4 5 6 7 8 b Figure S3 Southern hybridization analysis of hygromycin.

Slides:

Advertisements

Similar presentations

Lecture 18, Chapter 11 Analysis of transgenic plants part I

Advertisements

Transgenic Organisms.

P247. Figure 9-1 p248 Figure 9-2 p251 p251 Figure 9-3 p253.

Preparation of competent E. coli cells Preparation of probes by PCR Digestion of pBR322 and plasmid with restrionenzymes BamH1, EcoR1 and EcoRV Purification.

Katie Surckla.  hGM-CSF stands for human Granulocyte- Macrophage Colony Stimulating Factor  hGM-CSF is a cytokine which regulates the production and.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

& Gel Plasmid Electrophoresis Mapping.

{ Genetic Engineering Application of molecular genetics (understanding of DNA) for practical purposes.

1 Genetics Faculty of Agriculture Instructor: Dr. Jihad Abdallah Topic 13:Recombinant DNA Technology.

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Genetic Engineering An Overview. What is it??? Applied techniques of genetics and biotechnology (“Wet lab procedure”). Much trial and error. Applied techniques.

Biology 1060 Chapter 20 DNA Technology and Genomics.

AP Biology Biotech Tools Review AP Biology Biotech Tools Review  Recombinant DNA / Cloning gene  restriction enzyme, plasmids,

Chapter 20: DNA Technology and Genomics - Lots of different techniques - Many used in combination with each other - Uses information from every chapter.

Molecular Biology II Lecture 1 OrR. Restriction Endonuclease (sticky end)

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Workpackage 2: Breeding Systems

Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E.

Figure 1. Transposon-tagged mutant chromosome (cmsm). WT S. typhimurium cells (WT cmsm on left) were mutagenized by introducing a transposon (Tn) that.

BIO 208 NUCLEIC ACID METHODS Stephanie Schumaker.

Recombinant DNA & gene cloning Biology Donald Winslow 5 October 2010.

DNA cloning General strategies Choose DNA sources (gDNA/cDNA) Produce collection of DNA fragments Join them to appropriate vector Introduce rDNA to a host.

Volume 5, Issue 2, Pages (March 2012)

Table A. Sequences used in making CsKASII RNAi constructs

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

The Flavr Savr Tomato.

(A) SGT Antisense RNA construct

Supplemental Figure 1 A) B) C)

Genomic and cDNA Libraries

Chapter 4 Recombinant DNA Technology

(B.P :51) ( B:P52 ).

Figure 2. PFGE and Southern blot hybridization analysis results for E

Figure S5 Figure S5 Resistance assay of the OsNPR1-RNAi plants to rice bacterial blight pathogen Xoo. Gui99 is the untransformed control plant, and I1-I7.

Chapter 20: DNA Technology and Genomics

Biotech Tools Review

Lecture 12 Analysis of transgenic plants

Origin‐fork purification.

Volume 5, Issue 1, Pages (July 2015)

Supplementary Figure 1. Generation and characterization of T2/Onc2 transgenic founders. a, Tail biopsy DNA was digested with DraI, blotted and probed.

A Squalene Epoxidase Is Involved in Biosynthesis of Both the Antitumor Compound Clavaric Acid and Sterols in the Basidiomycete H. sublateritium Ramiro.

Molecular Biology Restriction enzymes.

Volume 5, Issue 2, Pages (March 2012)

Volume 7, Issue 6, Pages (December 1997)

Chapter 13 Review.

Wide geographic distribution of a unique methicillin-resistant Staphylococcus aureus clone in Hungarian hospitals Herminia de Lencastre, Elena P. Severina,

Volume 14, Issue 9, Pages (May 2004)

Jung-Ok Han, Sharri B Steen, David B Roth Molecular Cell

Expression of the 11β-hydroxysteroid dehydrogenase 2 gene in the mouse

Retroviral vector–mediated transfer and expression of human tissue plasminogen activator gene in human endothelial and vascular smooth muscle cells Daryoush.

Amplification and Overexpression of the EMS 1 Oncogene, a Possible Prognostic Marker, in Human Hepatocellular Carcinoma Bao-Zhu Yuan, Xiaoling Zhou,

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

Molecular epidemiology of extended-spectrum β-lactamase-producing Klebsiella pneumoniae strains in a university hospital in Tunis, Tunisia, 1999–2005

Chapter 20: DNA Technology and Genomics

Volume 10, Issue 4, Pages (April 2003)

Overexpression of BTAK/Aurora-A in ovarian carcinoma.

Evaluation of the BBL CrystalTM MRSA ID System for Rapid Detection of Methicillin Resistance in Staphylococcus aureus Sylvie Dutka-Malen, Murielle Charles,

Volume 7, Issue 12, Pages (December 2014)

Effect of Genome Size on AAV Vector Packaging

Targeting strategy and molecular verification of myoglobin disruption.

Hung-Yi Su, Jonathan G. H. Hickford, Pauline H. B. The, Anne M

BAC recombineering, gene targeting and RMCE strategies.

The Effect of Distance on Long-Range Chromatin Interactions

CpG methylation regulates the Igf2/H19 insulator

Biosynthesis of the Antitumor Chromomycin A3 in Streptomyces griseus

Biao Dong, Hiroyuki Nakai, Weidong Xiao Molecular Therapy

Volume 1, Issue 3, Pages (May 2008)

Meiotic DNA Breaks at the S. pombe Recombination Hot Spot M26

Presentation transcript:

Figure S3 Gui99 1 2 3 4 5 6 3.9kb a TP309 1 2 3 4 5 6 7 8 b Figure S3 Southern hybridization analysis of hygromycin resistant T1 plant lines. a Southern hybridization analysis of hygromycin resistant Gui99 OsNPR1-RNAi T1 plant lines. The 422 bp BamHI/SpeI DNA fragment released from digestion of plasmid pCAMBIA1301-OsNPR1i was used as a probe. Gui99 is the untransformed control plant. 1-6, Gui99 transgenic lines I1, I2, I3, I5, I6, and I7, respectively. b Southern hybridization analysis of hygromycin resistant TP309 OsNPR1-overexpressing T1 plant lines. The 3.1 kb EcoRV/XhoI DNA fragment (including partial OsNPR1 DNA) recovered from the digestion of plasmid pCAMBIA1301-UbiN-OsNPR1 was used as a probe. TP309 is the untransformed control plant; 1-8, TP309 transgenic lines 743, 758, 817, 878, 749, 862, 492, and 888, respectively.