Lect10: Mutations 6th Ed: Ch 8-1, 7-1, 7-2, 8-5

What is a gene? Prokaryotic Genes PROMOTER 3’ 5’ 3’ (-35) (-10) antisense ---TTGACAT------TATAAT-------AT-/-AGGAGGT-/-ATG CCC CTT TTG TGA ---AACTGTA------ATATTA-------TA-/-TCCTCCA-/-TAC GGG GAA AAC ATT sense 3’ (-35) (-10) RIBOSOME BINDING SITE 5’ 5’ 3’ U-/-AGGAGGU-/-AUG CCC CUU UUG UGA Met Pro leu leu stp When all of these rules are satisfied then A segment of DNA will generate an RNA which will then be read by a ribosome and be translated into a protein.

Reading the genetic code A T G T T T A A A T A G C C C 5’ 3’ C A T A A A T T T C T A G G G 5’ 3’ A T G T T T A A A T A G C C C 5’ 3’ 5’ 3’ A U G U U U A A A U A G C C C 5’ 3’ C A T A A A T T T C T A G G G A U G U U U A A A U A G C C C 5’ 3’ U A C Met A A A Phe U U U Lys S T P

No Gaps A U G U U U A A A U A G C C C 5’ 3’ U A C Met A A A Phe U U U Lys S T P A U G U U U A A A U A G C C C 5’ 3’ U A C Met A A U Asn U U A Leu

No overlaps A U G A A A C C C U A G 5’ 3’ U A C Met U U U Lys G G G Pro S T P A U G A A A C C C U A G 5’ 3’ U A C Met U U U Lys U G G Trp

The GENETIC CODE The code is a three letter code. Second letter U C A UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG U C A G Phe Tyr Cys U Ser STOP STOP Leu Trp His C Arg Pro Leu Gln First letter Third letter Asn Ser Ile A Thr Lys Arg Met Asp G Val Ala Gly Glu

The Genetic Code Properties of the Genetic code: 1- The code is written in a linear form using the nucleotides that comprise the mRNA 2- The code is a triplet: THREE nucleotides specify ONE amino acid 3- The code is degenerate: more than one triplet specifies a given amino acid 4- The code is unambiguous: each triplet specifies only 5- The code contains stop signs- There are three different stops 6- The code is comma less 7- The code is non-overlapping

xxxxxx

Mutations Most mutations are harmful in their effects; only rarely are mutations beneficial. A gene with one wild-type allele is monomorphic; a gene with two or more wild-type alleles is polymorphic. The vast majority of mutant traits are determined by alleles of more than one gene. This means that most traits are multifactorial traits. A Heterogeneous Trait is one that may be caused by mutations in more than one gene. Human deafness is an example of a heterogeneous trait: Mutations in any of at least 50 genes lead to deafness. An important class of mutations are conditional mutations- (Environment affects Phenotype). Conditional mutations are those that express their associated phenotype only under some conditions (restrictive conditions) and not others (permissive conditions). Conditional lethal mutations are common. Temperature-sensitive conditional mutations are invaluable in genetic research.

Generation of mutations Spontaneous mutations Replication induced mutations of DNA Usually base substitutions (Most errors are corrected) Meiosis- segregation defects or defects during crossing over can induce mutations Small additions and deletions AND Large changes as well Environment induced changes Exposure to physical mutagens - Radioactivity or chemicals Depurination (removal of A or G) Repair results in random substitution during replication Deamination (removal of amino group of base) (nitrous acid) Cytosine--uracil--bp adenine--replication-- Oxidation (oxoG) guanine--oxoguanine--bp adenine--replication -- Base analog incorporation during replication BU-T Intercalating agents

Mutation rate There are approximately 1013 cells in the human body Each cell receives 1000-10,000 DNA lesions per day (Lindahl and Barnes 2000). Almost all are repaired!! Most pervasive mutagen is UV. 100,000 lesions per exposed cell per hour (Jackson and Bartek 2009). Ionizing agents (X-rays/g-rays) are most toxic because they generate double strand breaks (Ward 1988). Chromosome instability (gain or loss of entire segments) is frequent - 40% of imbalances are entire arm imbalance while 45% are terminal segment imbalance (double strand break, nondysjunction etc) Sequencing 179 humans as part of the 1000 genome project: On average, each person is found to carry approximately 250 to 300 loss-of-function variants in genes of which 50 are in genes previously implicated in genetic disorders. Each individual on average has: 1.3 million short indels (1-10,000 bp) and 20,000 large sequence variations (>10,000 bp). Variation detected by the project is not evenly distributed across the genome: certain regions, containing repetitive sequences (sub-telomeres etc), show high rates of indels.

Sequencing the whole genomes of a family (2010 Science 328 636). 98 crossovers in maternal genome 57 crossovers in paternal genome Mutation rate is 1x10-8 per position per haploid genome (human genome is 3x109 bp) It was calculated that there are ~70 new alterations in each diploid human genome Some sites such as CpG sites mutate at a rate 11 times higher than other sites Exome sequencing of 2440 individuals (Science 2012 337 40) Each person has ~100 loss of function mutations (~35 nonsense). 20 loss of function mutations are homozygous Some alterations in sequence concentrate in specific geographic populations. Rare changes are population specific and their frequencies vary for each geographic population

Methods used to study mutations Gross chromosomal changes- deletions, insertions, inversions, translocations Cytology- microscopy- karyotype Small mutations Small deletions, insertions and point mutations Recombinant DNA technologies

This means that most traits are multifactorial. Most mutations are harmful in their effects; only rarely are mutations beneficial. A gene with one wild-type allele is monomorphic; a gene with two or more wild-type alleles is polymorphic. The vast majority of traits are determined by alleles of more than one gene. This means that most traits are multifactorial. A Heterogeneous Trait is One That May be caused by mutations in more than one gene. Human deafness is an example of a heterogeneous trait: mutations in any of at least 50 genes lead to deafness. (How can one tell if two deaf individuals carry mutations in the same gene or mutations in different genes?) An important class of mutations are conditional mutations. In these mutants the Environment affects Phenotype. Conditional mutations are those that express their associated phenotype only under some conditions (restrictive conditions) and not others (permissive conditions). Conditional lethal mutations are common. Temperature-sensitive conditional mutations are invaluable in genetic research.

Missense mutations UUU UUU UGC UUU UUU WT Phe Phe Cys Phe Phe Missense mutations alters ONE codon so that it encodes a different amino acid UUU UUU UGC UUU UUU WT Phe Phe Cys Phe Phe UUU UUU UGG UUU UUU mut Phe Phe Trp Phe Phe

Consequences of Missense Mutations Missense mutations alter one of the many amino acids that make a protein Its consequences depend on which amino acid is altered Conservative mutations: K to R Nonconservative mutations: K to E Surface Vs buried Mutations in globular domains Vs unstructured tails Silent mutations Mutations in non-coding regions Nonsense mutations

NNN UGG CGA UGG CGA UGG CGA UGG CGA NNN Frameshift mutations A single base-pair deletion or insertion results in a change in the reading frame NNN UGG CGA UGG CGA UGG CGA UGG CGA NNN Trp Arg Trp Arg Trp Arg Trp Arg Delete A NNN UGG CGU GGC GAU GGC GAU GGC GAN NN Trp Arg Gly Asp Gly Asp Gly Insert A NNN UGG CGA AUG GCG AUG GCG AUG GCG ANNN Trp Arg Met Ala Met Ala Met Ala

NNN UGGCGAUGGCGAUGGCGAUGGCGA NNN ... TrpArgTrpArgTRpArgTrpArg … Frameshift mutations A single base-pair deletion or insertion results in a change in the reading frame NNN UGGCGAUGGCGAUGGCGAUGGCGA NNN ... TrpArgTrpArgTRpArgTrpArg … .... GlyAspGlyAspGlyAspGlyAsp ..... AlaMetAlaMetAlaMetAla Delete A UGG CGU GGC GAU GGC GAU GGC GANN Trp Arg Gly Asp Gly Asp Gly Insert A UGG ACG AUG GCG AUG GCG AUG GCG ANN Trp Thr Met Ala Met Ala Met Ala

Frameshift mutations- Deletion Base-pair deletion or insertion results in a change in the reading frame AUG UUU AGC UUU AGC UUU AGC Met Phe Ser Phe Ser Phe Ser Delete C AUG UUU AGU UUA GCU UUA GC Met Phe Ser Leu Ala Leu Delete GC AUG UUU AUU UAG CUU UAG C Met Phe Ile Stp Delete AGC AUG UUU UUU AGC UUU AGC Met Phe Phe Ser Phe Ser

Frameshift mutations-Insertion Base-pair deletion or insertion results in a change in the reading frame AUG UUU AGC UUU AGC UUU AGC Met Phe Ser Phe Ser Phe Ser Insert C AUG UUU AGC CUU UAG CUU UAG C Met Phe Ser Leu STOP Insert CC AUG UUU AGC CCU UUA GCU UUA GC Met Phe Ser Pro Leu Ala Leu Insert CCC AUG UUU AGC CCC UUU AGC UUU AGC Met Phe Ser Pro Phe Ser Phe Ser

AUG UUU AGC UUU AGC UUU AGC WT Met Phe Ser Phe Ser Phe Ser Silent Mutations Silent mutations do not alter the amino acid sequence! The Genetic code is degenerate! AUG UUU AGC UUU AGC UUU AGC WT Met Phe Ser Phe Ser Phe Ser AUG UUC AGC UUU AGC UUU AGC Mut Mutations that occur within introns are often silent but mutations at splicing junctions have effects Mutations that occur in non-genic regions are often silent except when they occur in regulatory sequences

Mutations in non-protein coding regions Mutations in the promoter, splicing junction or ribosome binding site are also mutagenic Reduced expression of mRNA might result in reduced levels of proteins OR Increased expression of mRNA might result in increased levels of protein Mutations in splicing junctions may also be mutagenic improperly spliced mRNA will result in the intron being translated Mutations in tRNA or aminoacyl-tRNA synthase are mutagenic

Lactose intolerance in humans Lactose========>Glucose + Galactose Lactase Human milk is 7% lactose. Lactose is not absorbed through the wall of the digestive tract. In human infants, lactase is secreted in intestine which breaks the lactose into easily absorbed Glucose and Galactose. Production of the lactase enzyme declines in adults. The unabsorbed lactose creates cramps, diarrhea, and nausea. In some humans, lactase continues to be produced throughout adulthood. These individuals are called lactose absorbers (LA). Adult lactose absorption is inherited as an autosomal dominant trait. Lactose persistence and non-persistence reflect inheritance of different alleles of the lactase gene. Lactose intolerance is the result of being homozygous for the recessive lactase (WT) allele Being homozygous or heterozygous for the mutant allele allows lactase expression in adults when normally lactase expression is turned off.

Lactose tolerance There are no mutations in the coding region of the lactase gene. A mutation is observed in the enhancer -13910 bp upstream of the gene in an AP2 consensus sequence. CCCCAGGC the polymorphism modifies a transcription factor binding site (AP2) AP2 acts as a repressor but in the mutant it cannot bind and cannot repress the gene- so adults keep producing lactase CCCCAGGC TCCCAGGC

Synuclein Gene and Parkinson At one nucleotide in a non-protein-coding region of SNCA, the gene that encodes α-synuclein, the presence of the base adenine (A) is protective against Parkinson's disease, whereas the presence of another, guanine (G), confers increased risk. Soldner et al.3 report that this region regulates SNCA expression levels. If the two copies of the chromosome in a human cell each contain a different base at this site, gene expression is significantly higher from the risk-variant chromosome, owing to a reduction in the attachment of DNA-binding proteins that inhibit transcription. Using CRISPR–Cas9 gene-editing technology to remove the G and replace it with A reduces SNCA expression. http://www.nature.com/nature/journal/v533/n7601/full/nature17891.html

Mutations in splicing of RNA

UUU UUU UGC UUU UUU Phe Phe Cys Phe Phe UUU UUU UGA UUU UUU Nonsense mutations Nonsense mutations alter one codon so that it now encodes for a STOP codon UUU UUU UGC UUU UUU Phe Phe Cys Phe Phe UUU UUU UGA UUU UUU Phe Phe STOP Nonsense mutations insert a stop codon which results in premature termination Truncated polypeptide usually results in loss of function for polypeptide

A U G U A C A A A U A G C C C 5’ 3’ U A C Met A U G Trp U U U Lys There are NO tRNAs in wildtype cells with anti-codons that recognize STOP codons in mRNA What happens if there is a mutation in the anti-codon loop of a specific tRNA Gene that allows a tRNA to recognize a stop codon A U G U A C A A A U A G C C C 5’ 3’ U A C Met A U G Trp U U U Lys S T P

Nonsense suppressor mutations! These are the result of a mutation in the anti-codon loop of a specific tRNA Gene It allows the tRNA to recognize a nonsense codon and base pair with it. DNA Gene encoding tRNATRP Point mutation occurs in the anticodon loop OF THE tRNA This allows this tRNA to base pair with a stop codon and ? AUG Trp AUG Trp AUC Trp 5---UAC---UAG---UAA3’ 5--UAC---UAG---UAA3’ Normal tRNA Mutant tRNA

Nonsense suppressor --- UUU UUU UAG UUU UUU ----- --- Phe Phe STP Trp-tRNA has mutation in anticodon. This allows it to pair with a stop codon 5’--- UUU UUU UAG UUU UUU UAA-----3’ AUC Trp AAA Met Ala Phe --- Phe Phe Trp Phe Phe | A mutant protein that is larger than normal will be synthesized!!

Nonsense and Nonsense suppressor --- UUU UUU CAG UUU UUU ----- --- Phe Phe Gln Phe Phe --- Nonsense mutation --- UUU UUU UAG UUU UUU ----- --- Phe Phe STOP AUC Trp ---UAG--- What will happen if an individual carries both a nonsense mutation in a gene and a nonsense suppressor mutation in the anticodon loop of one of the trp-tRNA genes. 5’--- UUU UUU UAG UUU UUU -----3’ AUC Trp AAA Met Ala Phe Phe Phe Trp Phe Phe

Methods used to study mutations Gross chromosomal changes- deletions, insertions, inversions, translocations Cytology- microscopy- karyotype Small mutations Small deletions, insertions and point mutations Recombinant DNA technologies

Recombinant DNA technology When genes are mutated - proteins are mutated- DISEASE STATES OCCUR Sickle cell Anemia Globin 2 alpha globin chains 2 beta globin chains Mol wt 16100 daltons xfour = 64650 daltons Single point mutation in beta-globin Converts Glu to Val at position 6 Need to know mutation Need to look at genes of individuals Genes lie buried in 6billion base pairs of DNA (46 chromosomes). Molecular analyses necessary Take advantage of enzymes and reactions that naturally occur in bacteria

Why all the Hoopla? Why all the excitement over recombinant DNA? It provides a set of techniques that allows us to study biological processes at the level of individual proteins in individuals! It plays an essential role in understanding the genetic basis of cancer in humans Recently found that mutations in a single gene called p53 are the most common Genetic lesion in cancers. More than 50% of cancers contain a mutation in p53 Cells with mutant p53 Chromosomes fragment Abnormal number of chromosomes Abnormal cell proliferation!

Alkaptonuria Degenerative disease. Darkening of connective tissue, arthritis Darkening of urine Garrod characterized the disorder- using Mendels rules- Autosomal recessive. Affected individuals had normal parents and normal offspring. 1909 Garrod termed the defect- inborn error (genetic) of metabolism. Homogentisic acid is secreted in urine of these patients. This is an aromatic compound and so Garrod suggested that it was an intermediate that was accumulating in mutant individuals and was caused by lack of enzyme that splits aromatic rings of amino acids. 1958 La Du showed that accumulation of homogentistic acid is due to absence of enzyme in liver extracts Garrods results and his explanation were ignored 1994 Seidman mapped gene to chromosome 3 in human 1996 Gene cloned 1996 Mutant identified P230S &V300G 2000 Enzyme activity shown to be principally in liver and kidneys

p53 To understand the complete biological role of p53 protein and its mutant phenotype we need to study the gene at multiple levels: Genetics- mutant gene- mutant phenotype Now what? Genetics will relate specific mutation to specific phenotype It usually provides No Information about how the protein generates the phenotype For p53 We would like to know The nucleotide sequence of the gene and the mutation that leads to cancer When and in which cells the gene is normally expressed (in which cells is it transcribed) At the protein level--Amino acid sequence Three-dimensional structure Interactions with other proteins Cellular information Is the location in the cell affected How does it influence the behavior of the cell during division Organism phenotype