DNA vs. RNA

Contains sugar, nitrogen base & phosphate Warm-up: Read the article with a friend and categorize the following: 1 – DNA 2 – RNA 3 - Both Double Stranded Contains sugar, nitrogen base & phosphate Contains nitrogen bases cytosine, guanine, adenine, uracil Stays in the nucleus Single stranded Contains nitrogen bases cytosine, guanine, adenine, thymine http://www.saylor.org/site/wp-content/uploads/2010/11/BIO101-DNA-vs-RNA.pdf

Complimentary Strand Practice Original Strand: GCCATAGGATTTATATGGCATAT Complementary Strand: Is this a 1. DNA or 2. RNA Complimentary strand? How do you know? Make and RNA complementary strand for the original? Original Strand: GCCATAGGATTTATATGGCATAT GCCAUAGGAUUUAUAUGGCAUAU CGGTATCCTAAATATACCGTATA

Check-In What is unique to DNA base pairs compared to RNA base pairs G-C  A-T  A-U  There is no difference    Complete the table by writing “DNA” or “RNA” or “Both” in the box.  DNA, RNA, BOTH?  Double stranded    Contains the nitrogen bases cytosine,guanine, adenine, and thymine    Stays in the nucleus    Single stranded    Contains the nitrogen bases cytosine,guanine, adenine, and uracil    Provides the genetic “code” for assembling proteins    Found in the cytoplasm    Contains sugar, phosphate, and nitrogen base molecules   

Objective Differentiate the roles of DNA and the 3 forms of RNA in protein synthesis. DOL: Describe the process of protein synthesis using each of the 7 vocabulary words in a prof. CR.

DNA replication Must occur before a cell divides. Each new cell needs a copy of the information in order to grow.

DNA replication. Why needed? Before DNA strand can be replicated or copied it must be “unzipped” DNA polymerase (enzyme that unzips) Starts at many different points. Why?

Completing the replication After the DNA molecule comes apart, bases of free nucleotides in the nucleus join their complimentary bases.

RNA Very similar to DNA. Exceptions: Ribose is the 5-carbon sugar Uracil replaces thymine Single-stranded

RNA The answer is RNA RNA – Transfers the information from the DNA into brand new proteins. mRNA – Messenger RNA tRNA – Transfer RNA Ribosomal RNA

Where does this happen? Nucleus mRNA is made in the nucleus and is sent to the cytoplasm of the cell to be used to make new proteins. DNA is very long. Why wouldn’t the body just send the DNA out of the nucleus to make new proteins? Why bother with mRNA? Cytoplasm

Answer Since DNA is so long it would take a lot of work to move it all over the cell to make new proteins. Also, if you are only using one set of blueprints you can only make one new protein at a time. With mRNA you can make a lot of proteins at a time.

mRNA (messenger) Copies genetic code of DNA by matching bases. Occurs in the nucleus. DNA changing to RNA

tRNA (transfer) approx. 80 nucleotides in length. Cross-like shape At one end an amino acid is attached At the other end there is an anticodon Acts like a truck

What’s Next? tRNA has two ends: One end carries a piece of the protein (Amino Acid) the other end matches up to the mRNA at the right spot

Find Someone Who… DNA mRNA tRNA Ribosome Deoxyribo-nucleic Acid Abbreviation Name What is its Job? Where is it Found? DNA mRNA tRNA Ribosome Deoxyribo-nucleic Acid Holds body’s Blueprints Nucleus Makes a small copy of DNA info, carries to cytoplasm Nucleus and cytoplasm Messenger RNA Carries amino acids to mRNA to make proteins Transfer RNA Cytoplasm Holds the mRNA and tRNA when making proteins Cytoplasm

DOL Example DNA holds all of the body’s information in the nucleus. A copy of certain parts of that information is made and that copy is called mRNA. This new copy is carried out of the nucleus to the cytoplasm to the ribosome where tRNA carries amino acids over to be matched up with each other based on the instructions in the mRNA. The final result is a new protein molecule.