Review: Can you tell the story of protein synthesis?
Mutations 2007-2008
When do mutations affect the next generation? Point mutations single base change base-pair substitution silent mutation no amino acid change Due to “wobble” missense change amino acid nonsense change to stop codon When do mutations affect the next generation?
Point mutation leads to Sickle cell anemia What kind of mutation? Missense!
hydrophilic amino acid hydrophobic amino acid Sickle cell anemia Changes the shape of the hemoglobin protein One amino acid is different! hydrophilic amino acid hydrophobic amino acid
Mutations Frameshift shift in the reading frame insertions deletions changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?
mRNA processing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
Identify the mutation THE FAT CAT ATE THE RAT THE FAT BAT ATE THE RAT How could you change this sentence to show each kind of mutation? THE FAT CAT ATE THE RAT THE FAT BAT ATE THE RAT THE FAA TCA TAT ETH ERA T THA FAT CAT ATE THE RAT THE FAC ATA TET HER AT THE FAT CAT Nonsense Mutation (substitution) Missense Mutation (substitution) Insertion Mutation (frameshift) Silent Mutation (substitution) Deletion Mutation (frameshift)
What’s the value of mutations? 2007-2008