Review: Can you tell the story of protein synthesis?

Slides:

Advertisements

Similar presentations

Mutations From Gene to Protein Honors Biology Ms. Kim.

Advertisements

Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.

AP Biology Chapter 15. Mutations AP Biology Code is redundant  several codons for each amino acid  “wobble” in the tRNA  “wobble”

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

MUTATIONS _______________ are changes in the genetic material. MUTATIONS mistakes REMEMBER! Mutations can happen when cells make _____________ in.

CHAPTER 7 Gene Experssion and Control Part 3. MUTATED GENES AND THEIR PRODUCTS  Mutations are changes in the sequence of a cell’s DNA.  If a mutation.

Mutations (Ch. 17) Mutations Point mutations – single base change silent mutation – no amino acid change – redundancy in code missense – change amino.

Ch Mutations Section Objectives:

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Translation The decoding of an mRNA message into a polypeptide chain (aka a protein) is the known as translation The process begins when the mRNA reaches.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Section 11.3 MUTATIONS Section 11.3 pgs

MUTATIONS No this can’t happen with just mutations.

Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

DNA Mutations. Base Substitution: A substitution is a mutation that exchanges one base for another (switch A with a G) 1. changes a codon to one that.

BIOLOGY FALL 2014 MUTATIONS. WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Gene Mutations.

Gene Mutations.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Types of Mutations.

Chapter 17. Mutations

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Mutations (Ch. 17).

Changes in DNA that affect genetic information

Changes in DNA that affect genetic information

MUTATIONS 12-4.

Types of point mutations

To be successful today…

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

Do Now What is the central dogma of biology?

DNA MUTATIONS A mutation is a change in the DNA code.

Chapter 17 Mutations (PART 5)

Bellwork How do we account for the wide variety of organisms that are on the Earth?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

Mutation Notes.

DNA is a double helix shape, while RNA is a single strand.

DNA: The Blueprints For Life

Mutations (Ch. 17).

Review: Can you tell the story of protein synthesis?

Don’t let this happen to you!!

Protein Synthesis and Mutation

Mutations 1) Gene Mutations = change in pattern of DNA bases

Mutations: Changes in Genes

Presentation transcript:

Review: Can you tell the story of protein synthesis?

Mutations 2007-2008

When do mutations affect the next generation? Point mutations single base change base-pair substitution silent mutation no amino acid change Due to “wobble” missense change amino acid nonsense change to stop codon When do mutations affect the next generation?

Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

hydrophilic amino acid hydrophobic amino acid Sickle cell anemia Changes the shape of the hemoglobin protein One amino acid is different! hydrophilic amino acid hydrophobic amino acid

Mutations Frameshift shift in the reading frame insertions deletions changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

mRNA processing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

Identify the mutation THE FAT CAT ATE THE RAT THE FAT BAT ATE THE RAT How could you change this sentence to show each kind of mutation? THE FAT CAT ATE THE RAT THE FAT BAT ATE THE RAT THE FAA TCA TAT ETH ERA T THA FAT CAT ATE THE RAT THE FAC ATA TET HER AT THE FAT CAT Nonsense Mutation (substitution) Missense Mutation (substitution) Insertion Mutation (frameshift) Silent Mutation (substitution) Deletion Mutation (frameshift)

What’s the value of mutations? 2007-2008