Catalyst Create a circle map about mutations. Mutations.

Slides:



Advertisements
Similar presentations
Mutations. A. Introduction to Mutations -A mutation is a change in DNA sequence (order of nucleotides). -Mutations are important because they increase.
Advertisements

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
GENE EXPRESSION & MUTATIONS IN DNA
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.
Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.
Topic 4.1 Chromosomes, Genes, Alleles and Mutations.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation
Gene Mutations Chapter 11.
DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.
Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.
Mutations A change in the DNA of an organism. Conditions caused by Mutations Cancer – the genes that code for cell division have mutated. Normal cells.
Welcome to Genetic Mutations! 7x2WSY 7x2WSY.
DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
Mutations. I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription,
DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.
MUTATIONS Intro video
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons.
Mutation Notes: Chapter 11.
Mutations.
Mutations.
11.3 Mutations.
When things go wrong in the DNA!
Protein on Normal Red Blood Cells
Mutations.
Mermaid Syndrome Video.
Get ready for a good day!!! (Get Hype!)
Gene Mutations Chapter 11.
Biology Mutations SNL Biology Copyright Pearson Prentice Hall.
Mutations Announcement Quiz over Mutations on Monday!
Gene Mutations.
MUTATIONS.
Protein Synthesis.
Mutations.
Mutations.
Catalyst Create a circle map about mutations. Mutations.
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations.
Mutations.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
DNA and Mutations.
Changes in the nucleotide sequence of DNA or mRNA
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Decode the following message.
Welcome to Genetic Mutations!
DNA and Mutations.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
1) Base Mutations 2) Chromosomal Mutations
Mutations Notes.
11.3 Section Objectives – page 296
Mutations: Changes in Genes
Presentation transcript:

Catalyst Create a circle map about mutations. Mutations

Mutations

I. Mutations -Any change in DNA sequence (order of nucleotides) is a mutation. -Mutations can be caused by mistakes in DNA replication, in transcription, in cell division and by other outside factors.

II. Mutations in Reproductive (Sex) Cells -Mutations in sex cells (sperm and egg cells) can lead to changes in the DNA sequence which will can be passed down to a person’s children.

II. Mutations in sex cells -X-men and X-women would be a result of mutations in sex cells. These people inherited mutated (changed) DNA from their parents:

One last X-woman…

III. Mutations in Body Cells -Mutations in body cells cannot be passed on to your children, however, they can cause cancer or other problems in your body. A cancer cell.

III. Cancer as a result of mutations in body cells: A person with skin cancer-This is why it’s important to always wear sunscreen!

III. Cancer as a result of mutations in body cells: Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!

IV. Point mutation -A point mutation is a change in one base pair in a DNA sequence. A point mutation can cause an amino acid to change, which will change the structure of the protein being made. Example: AUG=Met AAG=Lys -Only one letter was changed (the A to a U) and the entire amino acid changed (from methionine to lysine).

IV. Point mutation Normal Point mutation mRNA Protein Stop Replace G with A Point mutation mRNA Protein Stop

Point mutations in our lives! -Sickle cell anemia is a blood disease caused by a point mutation. -A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu

Point mutations in our lives! -People with sickle cell anemia often experience a lot of pain and swelling and have trouble exercising.

V. Frameshift mutation -A frameshift mutation is when one nucleotide is added or deleted from the DNA strand. -A frameshift mutation is much worse than a point mutation because it causes the entire DNA sequence to be shifted over! Example: DNA: ATTAAACCG ATAAACCG Delete this T

V. Frameshift mutation Deletion of U Frameshift mutation mRNA Protein

Difference between a point mutation and a frameshift mutation.

Questions: Is this a point mutation or a frameshift mutation? -It’s a point mutation because only one nucleotide changed!

Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Point or frameshift? Point!

Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Point or frameshift?

ATCGCGTATTCG ATCGGGTATTCG Substitution ATCGCGTATTCG ATCGGGTATTCG

ATCGCGTATTCG ATCGCTATTCG Deletion ATCGCGTATTCG ATCGCTATTCG

ATCGCGTATTCG ATCGCGTTATTCG Insertion ATCGCGTATTCG ATCGCGTTATTCG