Gene Mutations Chapter 11.

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Chapter 17.5 Gene expression and Mutations

Mutation and Genetic Change

Mutations Chapter 12.4.

Definition : Any change in the nucleotide sequence of DNA.

Gene Mutations Chapter 11.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

What exactly is a mutated gene? Nope, that’s not it.

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

CH Mutations in Genes Objectives: 1.Describe the following types of mutations: a.Base substitution b.Base insertion or deletion 2. Explain what can.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Mutations: Definition: Changes in DNA in an organism. These changes can be problematic, can be helpful, or can have no effect. Mutations are what DRIVES.

Mutation Notes: Chapter 11.

Human Genetic Mutations

Gene Mutations.

11.3 Mutations.

Mermaid Syndrome Video.

Types of Mutations.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Mutations TSW identify and describe the various types of mutations and their effects.

Protein Synthesis.

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations changes in the DNA sequence that can be inherited

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Do Now What is the central dogma of biology?

Chapter 11.6 When it all goes Wrong

DNA and Mutations.

Mutations Section 12-4.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

1) Base Mutations 2) Chromosomal Mutations

Mutation Notes.

Mutations Notes.

I. Mutations A change in the genetic code

Mutations: Changes in Genes

Gene Mutations.

Presentation transcript:

Gene Mutations Chapter 11

DNA and Chromosomes Prokaryotes: Eukaryotes: DNA found in cytoplasm (no nucleus) as large, single molecule Eukaryotes: DNA in nucleus on many chromosomes (human = 46) DNA length - 1,000x’s longer than cell diameter (must be folded)

Mutations Mutation: changes in genetic material Can occur on single gene, or entire chromosome Causes: 1) Chance 2) Mutagens: factors that change DNA (i.e.: UV light, cigarette tar, radiation, etc.)

Gene Mutations 2 Types of Gene Mutations: 1) Point Mutations: occur at single point -may result in no change at all OR a genetic disorder (sickle-cell anemia) Substitution: 1or more nucleotides replaces another a) Silent- doesn’t change the amino acid b) Missense- changes the amino acid c) Nonsense- changes amino acid to “stop” Original DNA → Mutated DNA →

THE DOG BIT THE CAT THE DOG HIT THE CAT THE DOG HIT THE CAR THE GOG HIT THE CAR

Gene Mutations 2) Frameshift Mutations: shift in protein sequence; can ruin protein -result is usually devastating Insertion: 1or more nucleotides added Deletion: 1or more nucleotides removed Original DNA → Mutated DNA → Original DNA → Mutated DNA →

THE DOG BIT THE CAT THE DOB ITT HEC AT